\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216470460:

Variant ID: vg1216470460 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16470460
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.42, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGAGGAGCACTCGATAGAGCGAGAAGTGGCGTGTGCCATACCTCACGCCAGCCACGACCTAGAGTAGACCTCCCAGCTAGGGTTGTCAAAAAAAGCTC[G/A]
GATCTCGCAAGCTGCGCAAGCTTGATTCGTTATAGGCTTGATTTGAGCTCGGCTCGAATACTAGACAAGCCAAGCTCAAGCCTAGGCTGAGGCTCGCACG

Reverse complement sequence

CGTGCGAGCCTCAGCCTAGGCTTGAGCTTGGCTTGTCTAGTATTCGAGCCGAGCTCAAATCAAGCCTATAACGAATCAAGCTTGCGCAGCTTGCGAGATC[C/T]
GAGCTTTTTTTGACAACCCTAGCTGGGAGGTCTACTCTAGGTCGTGGCTGGCGTGAGGTATGGCACACGCCACTTCTCGCTCTATCGAGTGCTCCTCTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.50% 17.50% 0.74% 56.26% NA
All Indica  2759 26.10% 2.60% 1.20% 70.06% NA
All Japonica  1512 18.70% 48.50% 0.07% 32.74% NA
Aus  269 53.50% 0.70% 0.00% 45.72% NA
Indica I  595 3.70% 2.90% 1.51% 91.93% NA
Indica II  465 67.50% 4.30% 0.22% 27.96% NA
Indica III  913 13.30% 0.20% 1.75% 84.78% NA
Indica Intermediate  786 33.60% 4.20% 0.89% 61.32% NA
Temperate Japonica  767 0.90% 79.00% 0.13% 19.95% NA
Tropical Japonica  504 50.80% 4.40% 0.00% 44.84% NA
Japonica Intermediate  241 8.30% 43.60% 0.00% 48.13% NA
VI/Aromatic  96 27.10% 1.00% 0.00% 71.88% NA
Intermediate  90 33.30% 22.20% 1.11% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216470460 G -> DEL N N silent_mutation Average:45.029; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1216470460 G -> A LOC_Os12g27940.1 downstream_gene_variant ; 527.0bp to feature; MODIFIER silent_mutation Average:45.029; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1216470460 G -> A LOC_Os12g27940-LOC_Os12g27950 intergenic_region ; MODIFIER silent_mutation Average:45.029; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216470460 NA 1.20E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 9.12E-08 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 2.64E-07 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 7.22E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 3.15E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 5.19E-07 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 2.14E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 6.97E-07 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 1.48E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 8.49E-09 mr1912 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 1.33E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 1.86E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 4.45E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 6.71E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 9.39E-08 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216470460 NA 8.75E-07 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251