\
| Variant ID: vg1216470015 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16470015 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTTAATTTTAGAGGAAAACTGAAGTCGTCAAGTTGAGTACTTTACTATGGCCGTTAATGGTAGTATTATACTACCAGTATAATGGCCCTGTTTAGTTCG[C/T]
GAAAAGAAAATTTTTGGGTGTCATATCGAACGTTTGACCGGAAGTCGGAAAGGGTTTTCGGACACGAATAAAAAAACTAATTTCATCACTCGCATGGAAA
TTTCCATGCGAGTGATGAAATTAGTTTTTTTATTCGTGTCCGAAAACCCTTTCCGACTTCCGGTCAAACGTTCGATATGACACCCAAAAATTTTCTTTTC[G/A]
CGAACTAAACAGGGCCATTATACTGGTAGTATAATACTACCATTAACGGCCATAGTAAAGTACTCAACTTGACGACTTCAGTTTTCCTCTAAAATTAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.30% | 18.60% | 0.28% | 13.86% | NA |
| All Indica | 2759 | 61.70% | 24.80% | 0.22% | 13.34% | NA |
| All Japonica | 1512 | 77.50% | 11.20% | 0.26% | 10.98% | NA |
| Aus | 269 | 72.50% | 1.90% | 0.37% | 25.28% | NA |
| Indica I | 595 | 84.00% | 12.10% | 0.00% | 3.87% | NA |
| Indica II | 465 | 86.90% | 3.40% | 0.43% | 9.25% | NA |
| Indica III | 913 | 30.00% | 48.00% | 0.11% | 21.91% | NA |
| Indica Intermediate | 786 | 66.70% | 20.00% | 0.38% | 12.98% | NA |
| Temperate Japonica | 767 | 88.30% | 1.60% | 0.26% | 9.91% | NA |
| Tropical Japonica | 504 | 63.10% | 27.20% | 0.20% | 9.52% | NA |
| Japonica Intermediate | 241 | 73.40% | 8.70% | 0.41% | 17.43% | NA |
| VI/Aromatic | 96 | 44.80% | 4.20% | 1.04% | 50.00% | NA |
| Intermediate | 90 | 75.60% | 17.80% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216470015 | C -> DEL | N | N | silent_mutation | Average:33.358; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1216470015 | C -> T | LOC_Os12g27940.1 | downstream_gene_variant ; 82.0bp to feature; MODIFIER | silent_mutation | Average:33.358; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1216470015 | C -> T | LOC_Os12g27940-LOC_Os12g27950 | intergenic_region ; MODIFIER | silent_mutation | Average:33.358; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216470015 | 2.02E-06 | NA | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 2.61E-07 | NA | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 3.86E-08 | NA | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | NA | 1.78E-06 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 6.77E-06 | NA | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 5.38E-06 | NA | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | NA | 3.94E-06 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 7.92E-08 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 3.74E-06 | NA | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 2.68E-06 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | NA | 7.18E-07 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 9.10E-09 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | NA | 6.84E-06 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 1.69E-06 | NA | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 1.85E-06 | NA | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | NA | 1.35E-06 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 6.52E-09 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 1.05E-06 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 5.15E-09 | NA | mr1490_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216470015 | 1.65E-06 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |