\
| Variant ID: vg1216422627 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16422627 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 92. )
TTAGTAAAGTGGCAAATCTTGCGAAGTAGAGGCAATAGAGTTTGCCGGTGCAGAAGACAATGAAGATAAAGTCGCTCCACCATGGTGACAAAGTTGCATA[G/A]
CCGTGATGAAGTGAAGACACCATTGGCGGCGGCGAAGCCAACAGGCAATGACGATTACGCCAGTCAATGATGATGAAGACGCGCAGCTGTGGAGGCGAAC
GTTCGCCTCCACAGCTGCGCGTCTTCATCATCATTGACTGGCGTAATCGTCATTGCCTGTTGGCTTCGCCGCCGCCAATGGTGTCTTCACTTCATCACGG[C/T]
TATGCAACTTTGTCACCATGGTGGAGCGACTTTATCTTCATTGTCTTCTGCACCGGCAAACTCTATTGCCTCTACTTCGCAAGATTTGCCACTTTACTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.60% | 34.20% | 13.61% | 5.63% | NA |
| All Indica | 2759 | 64.20% | 12.80% | 19.32% | 3.70% | NA |
| All Japonica | 1512 | 10.00% | 76.60% | 4.37% | 9.06% | NA |
| Aus | 269 | 77.00% | 10.80% | 7.06% | 5.20% | NA |
| Indica I | 595 | 58.50% | 3.00% | 36.81% | 1.68% | NA |
| Indica II | 465 | 47.30% | 32.90% | 15.27% | 4.52% | NA |
| Indica III | 913 | 79.60% | 6.50% | 9.75% | 4.16% | NA |
| Indica Intermediate | 786 | 60.60% | 15.60% | 19.59% | 4.20% | NA |
| Temperate Japonica | 767 | 2.10% | 89.00% | 1.04% | 7.82% | NA |
| Tropical Japonica | 504 | 22.60% | 59.10% | 9.13% | 9.13% | NA |
| Japonica Intermediate | 241 | 8.70% | 73.40% | 4.98% | 12.86% | NA |
| VI/Aromatic | 96 | 51.00% | 26.00% | 14.58% | 8.33% | NA |
| Intermediate | 90 | 24.40% | 57.80% | 12.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216422627 | G -> DEL | N | N | silent_mutation | Average:33.092; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
| vg1216422627 | G -> A | LOC_Os12g27860.1 | upstream_gene_variant ; 268.0bp to feature; MODIFIER | silent_mutation | Average:33.092; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
| vg1216422627 | G -> A | LOC_Os12g27850-LOC_Os12g27860 | intergenic_region ; MODIFIER | silent_mutation | Average:33.092; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216422627 | NA | 4.07E-10 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | NA | 1.88E-28 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | 2.77E-07 | NA | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | 5.21E-08 | NA | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | NA | 3.60E-12 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | 2.00E-08 | NA | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | NA | 4.09E-11 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | NA | 5.38E-37 | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | 6.88E-07 | 2.33E-13 | mr1023_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | 2.63E-06 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | NA | 1.56E-13 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | 1.09E-06 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | NA | 7.52E-14 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | NA | 8.37E-13 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | 1.38E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | NA | 3.87E-13 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422627 | NA | 7.50E-12 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |