\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216346096:

Variant ID: vg1216346096 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16346096
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAAGTGAGGATGAGGTTTTAGCTAGGATATGTAAAGTTAGGGTATGTGCGTGGCAATGTCCTAGTTTTGTGACGCCGCTTACTTTAACACCACAAAAG[A/T]
TATCAAGAAGTATCACATATTGTTACTAGAATTTATGAATTTATAGTACCTTGCGGTTATCCTCTTGTACGACTATGAAAACCCAATTATAAATGTGGAC

Reverse complement sequence

GTCCACATTTATAATTGGGTTTTCATAGTCGTACAAGAGGATAACCGCAAGGTACTATAAATTCATAAATTCTAGTAACAATATGTGATACTTCTTGATA[T/A]
CTTTTGTGGTGTTAAAGTAAGCGGCGTCACAAAACTAGGACATTGCCACGCACATACCCTAACTTTACATATCCTAGCTAAAACCTCATCCTCACTTCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 10.20% 0.11% 2.01% NA
All Indica  2759 93.70% 5.50% 0.00% 0.80% NA
All Japonica  1512 82.20% 17.50% 0.00% 0.26% NA
Aus  269 74.00% 16.00% 0.74% 9.29% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 1.10% 0.00% 1.08% NA
Indica III  913 87.40% 11.60% 0.00% 0.99% NA
Indica Intermediate  786 93.60% 5.30% 0.00% 1.02% NA
Temperate Japonica  767 96.30% 3.70% 0.00% 0.00% NA
Tropical Japonica  504 61.10% 38.90% 0.00% 0.00% NA
Japonica Intermediate  241 81.30% 17.00% 0.00% 1.66% NA
VI/Aromatic  96 40.60% 12.50% 3.12% 43.75% NA
Intermediate  90 87.80% 10.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216346096 A -> DEL N N silent_mutation Average:37.036; most accessible tissue: Zhenshan97 young leaf, score: 62.534 N N N N
vg1216346096 A -> T LOC_Os12g27710.1 upstream_gene_variant ; 3271.0bp to feature; MODIFIER silent_mutation Average:37.036; most accessible tissue: Zhenshan97 young leaf, score: 62.534 N N N N
vg1216346096 A -> T LOC_Os12g27720.1 downstream_gene_variant ; 2487.0bp to feature; MODIFIER silent_mutation Average:37.036; most accessible tissue: Zhenshan97 young leaf, score: 62.534 N N N N
vg1216346096 A -> T LOC_Os12g27710-LOC_Os12g27720 intergenic_region ; MODIFIER silent_mutation Average:37.036; most accessible tissue: Zhenshan97 young leaf, score: 62.534 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216346096 1.86E-07 4.22E-17 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 3.07E-06 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 3.34E-07 8.05E-17 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 2.10E-11 NA mr1018 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 2.64E-09 6.92E-19 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 6.61E-06 NA mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 NA 1.17E-11 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 NA 1.64E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 2.56E-09 NA mr1055 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 5.87E-09 9.60E-19 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 NA 1.55E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 1.62E-07 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 6.01E-08 2.37E-18 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 NA 7.02E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 NA 1.23E-12 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 1.90E-07 2.66E-18 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 1.02E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 7.21E-08 4.17E-19 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 1.31E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 2.39E-06 1.38E-14 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 6.04E-07 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 NA 6.57E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 5.07E-09 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 4.98E-07 1.69E-14 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 NA 3.73E-11 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 1.39E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 3.98E-06 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 1.72E-11 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 4.82E-11 1.08E-22 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 4.50E-06 2.02E-16 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 5.80E-10 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 7.66E-10 1.46E-22 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 1.08E-09 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 2.46E-11 1.02E-24 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 2.44E-06 NA mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 9.54E-07 2.57E-12 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 3.57E-09 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 9.70E-14 1.22E-27 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 2.98E-09 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 1.65E-06 5.67E-17 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 3.55E-07 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 1.06E-12 2.38E-26 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 NA 2.60E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216346096 9.85E-07 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251