Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216282973:

Variant ID: vg1216282973 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16282973
Reference Allele: A	Alternative Allele: T,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCTATCGCATATAATACGACAGCCCGATATACATATGAGATTTGAGCCCAGAAGGAAAGCAACTCACACAAGTCCACAAATTGCCTTGTTGCGCTGCT[A/T,C]
TGTATTCCTGCTTTACTCCAAAAGACATTATTTTATTATATTATGGTCCCGTTCTTTTCTCTAGCAAGAGTTGGATGAAGATTAAGATTTTCGTGGTACG

Reverse complement sequence

CGTACCACGAAAATCTTAATCTTCATCCAACTCTTGCTAGAGAAAAGAACGGGACCATAATATAATAAAATAATGTCTTTTGGAGTAAAGCAGGAATACA[T/A,G]
AGCAGCGCAACAAGGCAATTTGTGGACTTGTGTGAGTTGCTTTCCTTCTGGGCTCAAATCTCATATGTATATCGGGCTGTCGTATTATATGCGATAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	30.20%	1.67%	12.91%	C: 0.49%
All Indica	2759	89.60%	5.10%	1.92%	2.79%	C: 0.58%
All Japonica	1512	2.60%	70.30%	0.66%	26.32%	C: 0.07%
Aus	269	16.40%	36.80%	4.09%	42.01%	C: 0.74%
Indica I	595	92.40%	1.70%	3.87%	1.85%	C: 0.17%
Indica II	465	89.70%	4.70%	1.51%	3.23%	C: 0.86%
Indica III	913	91.20%	5.30%	0.66%	1.97%	C: 0.88%
Indica Intermediate	786	85.40%	7.90%	2.16%	4.20%	C: 0.38%
Temperate Japonica	767	0.70%	96.50%	0.26%	2.61%	NA
Tropical Japonica	504	5.20%	25.20%	1.59%	67.86%	C: 0.20%
Japonica Intermediate	241	3.70%	81.30%	0.00%	14.94%	NA
VI/Aromatic	96	1.00%	88.50%	1.04%	7.29%	C: 2.08%
Intermediate	90	32.20%	44.40%	4.44%	16.67%	C: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216282973	A -> C	LOC_Os12g27650.1	downstream_gene_variant ; 3092.0bp to feature; MODIFIER	silent_mutation	Average:59.706; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg1216282973	A -> C	LOC_Os12g27650-LOC_Os12g27670	intergenic_region ; MODIFIER	silent_mutation	Average:59.706; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg1216282973	A -> DEL	N	N	silent_mutation	Average:59.706; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg1216282973	A -> T	LOC_Os12g27650.1	downstream_gene_variant ; 3092.0bp to feature; MODIFIER	silent_mutation	Average:59.706; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg1216282973	A -> T	LOC_Os12g27650-LOC_Os12g27670	intergenic_region ; MODIFIER	silent_mutation	Average:59.706; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216282973	4.06E-07	8.58E-14	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	4.75E-06	2.99E-13	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	8.31E-07	4.05E-12	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	6.99E-07	2.71E-13	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	NA	1.13E-06	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	7.23E-07	1.08E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	5.87E-07	NA	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	NA	5.60E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	NA	4.57E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	NA	1.57E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	1.16E-06	NA	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	3.56E-07	1.60E-12	mr1055_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	1.96E-06	3.50E-09	mr1071_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	4.24E-06	1.25E-08	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	1.22E-06	1.47E-08	mr1203_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	5.81E-06	6.60E-09	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	3.52E-08	1.79E-10	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	NA	1.12E-06	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	NA	6.45E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973	NA	1.15E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251