\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216282973:

Variant ID: vg1216282973 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16282973
Reference Allele: AAlternative Allele: T,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCTATCGCATATAATACGACAGCCCGATATACATATGAGATTTGAGCCCAGAAGGAAAGCAACTCACACAAGTCCACAAATTGCCTTGTTGCGCTGCT[A/T,C]
TGTATTCCTGCTTTACTCCAAAAGACATTATTTTATTATATTATGGTCCCGTTCTTTTCTCTAGCAAGAGTTGGATGAAGATTAAGATTTTCGTGGTACG

Reverse complement sequence

CGTACCACGAAAATCTTAATCTTCATCCAACTCTTGCTAGAGAAAAGAACGGGACCATAATATAATAAAATAATGTCTTTTGGAGTAAAGCAGGAATACA[T/A,G]
AGCAGCGCAACAAGGCAATTTGTGGACTTGTGTGAGTTGCTTTCCTTCTGGGCTCAAATCTCATATGTATATCGGGCTGTCGTATTATATGCGATAGCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 30.20% 1.67% 12.91% C: 0.49%
All Indica  2759 89.60% 5.10% 1.92% 2.79% C: 0.58%
All Japonica  1512 2.60% 70.30% 0.66% 26.32% C: 0.07%
Aus  269 16.40% 36.80% 4.09% 42.01% C: 0.74%
Indica I  595 92.40% 1.70% 3.87% 1.85% C: 0.17%
Indica II  465 89.70% 4.70% 1.51% 3.23% C: 0.86%
Indica III  913 91.20% 5.30% 0.66% 1.97% C: 0.88%
Indica Intermediate  786 85.40% 7.90% 2.16% 4.20% C: 0.38%
Temperate Japonica  767 0.70% 96.50% 0.26% 2.61% NA
Tropical Japonica  504 5.20% 25.20% 1.59% 67.86% C: 0.20%
Japonica Intermediate  241 3.70% 81.30% 0.00% 14.94% NA
VI/Aromatic  96 1.00% 88.50% 1.04% 7.29% C: 2.08%
Intermediate  90 32.20% 44.40% 4.44% 16.67% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216282973 A -> C LOC_Os12g27650.1 downstream_gene_variant ; 3092.0bp to feature; MODIFIER silent_mutation Average:59.706; most accessible tissue: Minghui63 root, score: 75.485 N N N N
vg1216282973 A -> C LOC_Os12g27650-LOC_Os12g27670 intergenic_region ; MODIFIER silent_mutation Average:59.706; most accessible tissue: Minghui63 root, score: 75.485 N N N N
vg1216282973 A -> DEL N N silent_mutation Average:59.706; most accessible tissue: Minghui63 root, score: 75.485 N N N N
vg1216282973 A -> T LOC_Os12g27650.1 downstream_gene_variant ; 3092.0bp to feature; MODIFIER silent_mutation Average:59.706; most accessible tissue: Minghui63 root, score: 75.485 N N N N
vg1216282973 A -> T LOC_Os12g27650-LOC_Os12g27670 intergenic_region ; MODIFIER silent_mutation Average:59.706; most accessible tissue: Minghui63 root, score: 75.485 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216282973 4.06E-07 8.58E-14 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 4.75E-06 2.99E-13 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 8.31E-07 4.05E-12 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 6.99E-07 2.71E-13 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 NA 1.13E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 7.23E-07 1.08E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 5.87E-07 NA mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 NA 5.60E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 NA 4.57E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 NA 1.57E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 1.16E-06 NA mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 3.56E-07 1.60E-12 mr1055_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 1.96E-06 3.50E-09 mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 4.24E-06 1.25E-08 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 1.22E-06 1.47E-08 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 5.81E-06 6.60E-09 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 3.52E-08 1.79E-10 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 NA 1.12E-06 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 NA 6.45E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282973 NA 1.15E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251