Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216282445:

Variant ID: vg1216282445 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16282445
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

ACATAATCAGTATTCGGCAAACCCACATTATCGCCACAAACAACAATCTTATTCGTGAAACAGTCGACGGTACAAGCAAACCTGATAAGTGTTTCCATGG[T/A]
GGAAGCCGCTGTCAAGGGCTACCATCCTGCACGGCGCATGGCGGCGGTGGCCTCCTACGCGAGGAGACAAATGGCAGCGGCAGTGCACGGTGTGGCGCGG

Reverse complement sequence

CCGCGCCACACCGTGCACTGCCGCTGCCATTTGTCTCCTCGCGTAGGAGGCCACCGCCGCCATGCGCCGTGCAGGATGGTAGCCCTTGACAGCGGCTTCC[A/T]
CCATGGAAACACTTATCAGGTTTGCTTGTACCGTCGACTGTTTCACGAATAAGATTGTTGTTTGTGGCGATAATGTGGGTTTGCCGAATACTGATTATGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.10%	8.10%	1.27%	59.46%	NA
All Indica	2759	5.90%	12.80%	1.20%	80.10%	NA
All Japonica	1512	70.60%	1.20%	1.32%	26.85%	NA
Aus	269	38.70%	1.10%	0.74%	59.48%	NA
Indica I	595	2.40%	5.70%	0.34%	91.60%	NA
Indica II	465	5.60%	25.40%	0.43%	68.60%	NA
Indica III	913	5.70%	12.50%	1.86%	79.96%	NA
Indica Intermediate	786	9.20%	10.90%	1.53%	78.37%	NA
Temperate Japonica	767	97.40%	0.10%	0.13%	2.35%	NA
Tropical Japonica	504	24.80%	2.80%	3.57%	68.85%	NA
Japonica Intermediate	241	81.30%	1.20%	0.41%	17.01%	NA
VI/Aromatic	96	91.70%	0.00%	1.04%	7.29%	NA
Intermediate	90	53.30%	12.20%	4.44%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216282445	T -> DEL	N	N	silent_mutation	Average:34.001; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg1216282445	T -> A	LOC_Os12g27650.1	downstream_gene_variant ; 2564.0bp to feature; MODIFIER	silent_mutation	Average:34.001; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg1216282445	T -> A	LOC_Os12g27650-LOC_Os12g27670	intergenic_region ; MODIFIER	silent_mutation	Average:34.001; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216282445	3.80E-07	4.95E-12	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	6.65E-06	NA	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	1.57E-07	6.03E-12	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	2.43E-07	NA	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	7.16E-08	6.71E-12	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	4.04E-06	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	5.96E-06	NA	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	5.62E-08	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	2.20E-08	NA	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	1.59E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	1.89E-06	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	2.25E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	1.65E-16	mr1401	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	6.10E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	4.07E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	4.93E-06	NA	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	3.49E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	1.74E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	1.94E-06	NA	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	5.10E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	1.41E-06	NA	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	1.91E-08	4.02E-10	mr1071_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	1.90E-07	4.95E-09	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	6.49E-08	1.51E-08	mr1203_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	2.61E-08	2.19E-10	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	6.67E-06	2.61E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	2.80E-16	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282445	NA	2.08E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251