Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216279961:

Variant ID: vg1216279961 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16279961
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGCTTATCAGGAACTCTAGGCTAGGAACTTGCACTCCCACCGGCTTGGCACTGCAGGATACGCCAGGAAGGAACAACAATGGTAGGAGGAGGATGAAA[C/T]
GGTAGGGGAATCAAACACGCCGCCGGTGTTTGGCGATATCCCACACCCATGAGCAAGGAACTGGGCAAGGGCAAAGGGTCACAAGAACGACGATGGGACA

Reverse complement sequence

TGTCCCATCGTCGTTCTTGTGACCCTTTGCCCTTGCCCAGTTCCTTGCTCATGGGTGTGGGATATCGCCAAACACCGGCGGCGTGTTTGATTCCCCTACC[G/A]
TTTCATCCTCCTCCTACCATTGTTGTTCCTTCCTGGCGTATCCTGCAGTGCCAAGCCGGTGGGAGTGCAAGTTCCTAGCCTAGAGTTCCTGATAAGCCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 33.70% 0.30% 10.16% NA
All Indica  2759 85.50% 9.80% 0.25% 4.42% NA
All Japonica  1512 15.40% 71.30% 0.46% 12.83% NA
Aus  269 3.70% 38.70% 0.00% 57.62% NA
Indica I  595 94.30% 2.00% 0.00% 3.70% NA
Indica II  465 65.80% 24.70% 0.86% 8.60% NA
Indica III  913 91.20% 5.90% 0.22% 2.63% NA
Indica Intermediate  786 84.00% 11.30% 0.13% 4.58% NA
Temperate Japonica  767 2.30% 97.40% 0.00% 0.26% NA
Tropical Japonica  504 36.70% 26.60% 1.39% 35.32% NA
Japonica Intermediate  241 12.40% 81.70% 0.00% 5.81% NA
VI/Aromatic  96 7.30% 91.70% 0.00% 1.04% NA
Intermediate  90 34.40% 56.70% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216279961 C -> DEL N N silent_mutation Average:32.958; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg1216279961 C -> T LOC_Os12g27640.1 upstream_gene_variant ; 4482.0bp to feature; MODIFIER silent_mutation Average:32.958; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg1216279961 C -> T LOC_Os12g27650.1 downstream_gene_variant ; 80.0bp to feature; MODIFIER silent_mutation Average:32.958; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg1216279961 C -> T LOC_Os12g27650-LOC_Os12g27670 intergenic_region ; MODIFIER silent_mutation Average:32.958; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216279961 C T -0.01 -0.02 -0.02 0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216279961 7.53E-06 NA mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 4.26E-06 mr1268 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 4.32E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 5.43E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 4.02E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 2.71E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 1.94E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 2.14E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 1.75E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 4.64E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 6.02E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 1.94E-11 NA mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 1.55E-09 NA mr1023_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 4.70E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 1.18E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 1.40E-14 NA mr1055_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 6.35E-06 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 2.41E-13 NA mr1079_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 7.11E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 3.97E-12 NA mr1132_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 8.08E-16 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 1.72E-09 NA mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 7.81E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 1.36E-06 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 5.43E-07 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 3.72E-12 NA mr1390_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 1.07E-09 3.49E-08 mr1489_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 3.21E-07 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 1.64E-12 NA mr1490_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 5.17E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279961 NA 1.57E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251