Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216279538:

Variant ID: vg1216279538 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16279538
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTGCATTGAAGTTAAGCAGATCTCCCAGGCCATCGTGTTTTCACATCAACAACCACCTAGGAGTGCTTACTCATGCCCCCAAGGTTTGGAGAGGTACA[G/T]
GTTGATCTGCAGAGTCATAGGGTGCGAGAACTTCTCAATTCTTGTGGATGACATCAAACTAGTGCTGGAAGCCGAGAAGAACACTACTTGGCTAAAGTTC

Reverse complement sequence

GAACTTTAGCCAAGTAGTGTTCTTCTCGGCTTCCAGCACTAGTTTGATGTCATCCACAAGAATTGAGAAGTTCTCGCACCCTATGACTCTGCAGATCAAC[C/A]
TGTACCTCTCCAAACCTTGGGGGCATGAGTAAGCACTCCTAGGTGGTTGTTGATGTGAAAACACGATGGCCTGGGAGATCTGCTTAACTTCAATGCAGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.50%	41.80%	0.28%	10.43%	NA
All Indica	2759	33.20%	61.80%	0.25%	4.75%	NA
All Japonica	1512	71.40%	15.30%	0.26%	13.03%	NA
Aus	269	38.70%	3.00%	0.37%	57.99%	NA
Indica I	595	13.80%	82.20%	0.00%	4.03%	NA
Indica II	465	29.50%	60.40%	0.86%	9.25%	NA
Indica III	913	50.30%	46.80%	0.11%	2.85%	NA
Indica Intermediate	786	30.30%	64.60%	0.25%	4.83%	NA
Temperate Japonica	767	97.40%	2.30%	0.00%	0.26%	NA
Tropical Japonica	504	26.80%	36.50%	0.79%	35.91%	NA
Japonica Intermediate	241	82.20%	12.00%	0.00%	5.81%	NA
VI/Aromatic	96	93.80%	5.20%	0.00%	1.04%	NA
Intermediate	90	62.20%	27.80%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216279538	G -> DEL	LOC_Os12g27650.1	N	frameshift_variant	Average:29.14; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	N	N	N	N
vg1216279538	G -> T	LOC_Os12g27650.1	missense_variant ; p.Arg51Met; MODERATE	nonsynonymous_codon ; R51M	Average:29.14; most accessible tissue: Zhenshan97 flag leaf, score: 68.703	unknown	unknown	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216279538	7.14E-08	NA	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	1.63E-07	NA	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	3.16E-08	NA	mr1022	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	1.88E-07	NA	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	1.04E-06	NA	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	5.95E-06	NA	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	6.99E-06	NA	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	3.04E-06	mr1268	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	1.86E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	1.62E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	6.87E-08	NA	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	8.14E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	6.16E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	1.50E-07	NA	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	7.79E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	3.92E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	1.00E-11	NA	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	7.97E-08	NA	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	1.54E-12	1.17E-12	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	2.67E-11	2.93E-12	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	4.08E-11	1.47E-11	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	1.72E-16	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	5.01E-06	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	3.88E-11	NA	mr1178_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	9.48E-08	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	3.32E-11	4.57E-13	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	5.15E-07	4.49E-08	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	3.92E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	5.18E-12	2.61E-13	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	3.47E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	9.69E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279538	NA	2.62E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251