\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216278238:

Variant ID: vg1216278238 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16278238
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGGCATCAGATTCAGAGAAGAAGGACGAAGATCAAAGCGGATTTGGTGTTGAATCTAAATGAACTTGGAGTCAGACTGCGCATCGGTTGGATACTGTG[C/T]
CGGCTGAAAATAGAGTATGAAGTTGATCGAGGTTGATGAAGCCAATGGCCGATACAGCATGACTTGGTCTCGGCATAGGCCTAGAGTGGGAAAATCGTCA

Reverse complement sequence

TGACGATTTTCCCACTCTAGGCCTATGCCGAGACCAAGTCATGCTGTATCGGCCATTGGCTTCATCAACCTCGATCAACTTCATACTCTATTTTCAGCCG[G/A]
CACAGTATCCAACCGATGCGCAGTCTGACTCCAAGTTCATTTAGATTCAACACCAAATCCGCTTTGATCTTCGTCCTTCTTCTCTGAATCTGATGCCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 33.00% 0.76% 10.81% NA
All Indica  2759 84.50% 9.10% 1.16% 5.29% NA
All Japonica  1512 15.70% 70.50% 0.00% 13.76% NA
Aus  269 4.50% 39.00% 1.49% 55.02% NA
Indica I  595 93.60% 1.70% 1.01% 3.70% NA
Indica II  465 64.90% 21.90% 2.58% 10.54% NA
Indica III  913 89.90% 6.00% 0.66% 3.40% NA
Indica Intermediate  786 82.70% 10.70% 1.02% 5.60% NA
Temperate Japonica  767 2.50% 97.30% 0.00% 0.26% NA
Tropical Japonica  504 37.50% 24.40% 0.00% 38.10% NA
Japonica Intermediate  241 12.40% 81.70% 0.00% 5.81% NA
VI/Aromatic  96 7.30% 91.70% 0.00% 1.04% NA
Intermediate  90 37.80% 53.30% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216278238 C -> DEL N N silent_mutation Average:24.461; most accessible tissue: Callus, score: 48.198 N N N N
vg1216278238 C -> T LOC_Os12g27640.1 upstream_gene_variant ; 2759.0bp to feature; MODIFIER silent_mutation Average:24.461; most accessible tissue: Callus, score: 48.198 N N N N
vg1216278238 C -> T LOC_Os12g27650.1 intron_variant ; MODIFIER silent_mutation Average:24.461; most accessible tissue: Callus, score: 48.198 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216278238 8.73E-07 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 1.04E-09 NA mr1016 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 1.82E-07 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 5.13E-07 NA mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 3.20E-07 NA mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 2.02E-06 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 1.76E-08 NA mr1055 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 1.29E-06 NA mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 2.09E-06 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 5.51E-07 NA mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 8.48E-06 NA mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 9.48E-06 NA mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 1.71E-06 mr1268 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 4.32E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 2.02E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 4.02E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 4.24E-08 NA mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 2.71E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 9.26E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 2.14E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 4.26E-06 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 7.05E-08 NA mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 1.75E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 4.64E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 5.11E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 3.54E-07 NA mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 4.70E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 4.97E-06 NA mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 2.77E-06 NA mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 4.48E-06 NA mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 7.00E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 4.83E-06 NA mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 2.68E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 1.36E-06 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 4.24E-06 NA mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 1.63E-06 NA mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278238 NA 5.17E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251