\
| Variant ID: vg1216258965 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16258965 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )
GGTCTTTCTCTCTCTAAATATACAGTATATATACAACGACTTAGTGAATGCGCACAGTCTTGCCTGGGTCTGATCCATCAATATATGGTGACAATGGTAT[C/G]
GATGCACTAAAAGAGCAATCTGCTGCTCAAGTTCGGTTCGTAGCTAACGAAAAATGCTTGGTGTGATTGAGATCCTAGTTGGGAATGGAAGGAATCAAGA
TCTTGATTCCTTCCATTCCCAACTAGGATCTCAATCACACCAAGCATTTTTCGTTAGCTACGAACCGAACTTGAGCAGCAGATTGCTCTTTTAGTGCATC[G/C]
ATACCATTGTCACCATATATTGATGGATCAGACCCAGGCAAGACTGTGCGCATTCACTAAGTCGTTGTATATATACTGTATATTTAGAGAGAGAAAGACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.80% | 1.30% | 14.49% | 27.42% | NA |
| All Indica | 2759 | 47.30% | 1.70% | 16.20% | 34.76% | NA |
| All Japonica | 1512 | 72.90% | 0.90% | 14.09% | 12.10% | NA |
| Aus | 269 | 46.10% | 0.00% | 2.97% | 50.93% | NA |
| Indica I | 595 | 76.00% | 1.50% | 9.92% | 12.61% | NA |
| Indica II | 465 | 38.70% | 2.80% | 13.55% | 44.95% | NA |
| Indica III | 913 | 30.40% | 0.90% | 22.89% | 45.78% | NA |
| Indica Intermediate | 786 | 50.30% | 2.30% | 14.76% | 32.70% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 0.78% | 0.91% | NA |
| Tropical Japonica | 504 | 29.00% | 2.20% | 37.90% | 30.95% | NA |
| Japonica Intermediate | 241 | 84.20% | 0.80% | 6.64% | 8.30% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 3.12% | 4.17% | NA |
| Intermediate | 90 | 68.90% | 1.10% | 15.56% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216258965 | C -> DEL | N | N | silent_mutation | Average:52.565; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg1216258965 | C -> G | LOC_Os12g27630.1 | downstream_gene_variant ; 3750.0bp to feature; MODIFIER | silent_mutation | Average:52.565; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg1216258965 | C -> G | LOC_Os12g27610-LOC_Os12g27630 | intergenic_region ; MODIFIER | silent_mutation | Average:52.565; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216258965 | NA | 4.61E-07 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | 3.79E-06 | 4.27E-09 | mr1364 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | NA | 9.58E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | NA | 6.41E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | NA | 3.01E-06 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | 4.05E-06 | 2.59E-09 | mr1443 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | NA | 8.10E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | NA | 2.36E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | NA | 1.44E-08 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | NA | 8.16E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | NA | 5.73E-06 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | NA | 6.69E-07 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | NA | 9.87E-08 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216258965 | NA | 7.06E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |