\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216247174:

Variant ID: vg1216247174 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16247174
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAATAGCATTTAATAAATATTTCAGAATTTAATAAAACAGTTAAGTAATAAGTAAACAATATTAATCCAACGCTATACAACATACCCTATTGCATAGG[C/T]
CCAACCATTCTGAACAACCAATCCCGGCTGCACAGTTCTATCTCCAAACCAGGAATTAACCATTCCAAACCATGTGCTAAACAAGTTATTACCAATTACA

Reverse complement sequence

TGTAATTGGTAATAACTTGTTTAGCACATGGTTTGGAATGGTTAATTCCTGGTTTGGAGATAGAACTGTGCAGCCGGGATTGGTTGTTCAGAATGGTTGG[G/A]
CCTATGCAATAGGGTATGTTGTATAGCGTTGGATTAATATTGTTTACTTATTACTTAACTGTTTTATTAAATTCTGAAATATTTATTAAATGCTATTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 1.10% 2.33% 16.95% NA
All Indica  2759 76.90% 0.20% 0.47% 22.36% NA
All Japonica  1512 81.30% 2.70% 6.22% 9.72% NA
Aus  269 86.20% 2.20% 0.74% 10.78% NA
Indica I  595 66.10% 0.00% 0.17% 33.78% NA
Indica II  465 75.30% 0.60% 1.94% 22.15% NA
Indica III  913 86.00% 0.20% 0.22% 13.58% NA
Indica Intermediate  786 75.70% 0.10% 0.13% 24.05% NA
Temperate Japonica  767 98.00% 0.10% 0.65% 1.17% NA
Tropical Japonica  504 53.20% 7.70% 15.87% 23.21% NA
Japonica Intermediate  241 87.10% 0.40% 3.73% 8.71% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 1.10% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216247174 C -> DEL LOC_Os12g27600.1 N frameshift_variant Average:13.146; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1216247174 C -> T LOC_Os12g27600.1 missense_variant ; p.Ala50Thr; MODERATE nonsynonymous_codon ; A50T Average:13.146; most accessible tissue: Minghui63 panicle, score: 25.313 unknown unknown TOLERATED 0.20

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216247174 3.51E-06 3.51E-06 mr1058 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 4.59E-06 NA mr1147 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 1.45E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 3.72E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 2.16E-06 2.16E-06 mr1307 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 7.46E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 1.07E-06 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 3.04E-06 mr1352 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 2.09E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 4.32E-07 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 1.41E-06 1.41E-06 mr1393 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 2.90E-07 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 9.17E-07 9.17E-07 mr1417 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 5.45E-07 5.44E-07 mr1424 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 1.64E-06 1.64E-06 mr1564 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 2.27E-06 2.27E-06 mr1605 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 5.03E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 8.25E-07 mr1633 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 6.97E-06 6.97E-06 mr1635 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 9.71E-06 7.80E-09 mr1653 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 2.16E-06 2.16E-06 mr1661 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 7.43E-07 mr1682 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 9.92E-08 mr1700 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 4.16E-06 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 1.83E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 3.20E-07 8.31E-09 mr1884 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 1.95E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 5.71E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 1.62E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 1.67E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 5.66E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216247174 NA 9.61E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251