\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216084510:

Variant ID: vg1216084510 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16084510
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATCAGTGACCTTTACGTCGTGACGGGCACCATACCCGACATAGATGGAGATTGCTGCCCGATTGAGATGTGGGTGACCATTGTAGTGAATTTGTTTGA[G/T]
GGGACACCCCAATGGGAACAGTGATGCTTGTTATTTTTCTAGGAATTTGTTTGAGAGGTATTTGAGCATTTTGTAATCAGATTTGAATTTAAATTTTGAT

Reverse complement sequence

ATCAAAATTTAAATTCAAATCTGATTACAAAATGCTCAAATACCTCTCAAACAAATTCCTAGAAAAATAACAAGCATCACTGTTCCCATTGGGGTGTCCC[C/A]
TCAAACAAATTCACTACAATGGTCACCCACATCTCAATCGGGCAGCAATCTCCATCTATGTCGGGTATGGTGCCCGTCACGACGTAAAGGTCACTGATGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.60% 28.60% 0.38% 35.48% NA
All Indica  2759 43.30% 6.90% 0.54% 49.29% NA
All Japonica  1512 28.80% 64.60% 0.07% 6.48% NA
Aus  269 3.70% 23.00% 0.74% 72.49% NA
Indica I  595 33.60% 10.10% 0.84% 55.46% NA
Indica II  465 35.50% 8.40% 0.65% 55.48% NA
Indica III  913 58.90% 2.20% 0.22% 38.66% NA
Indica Intermediate  786 37.20% 8.90% 0.64% 53.31% NA
Temperate Japonica  767 1.60% 95.60% 0.00% 2.87% NA
Tropical Japonica  504 75.60% 12.70% 0.20% 11.51% NA
Japonica Intermediate  241 17.80% 74.70% 0.00% 7.47% NA
VI/Aromatic  96 7.30% 82.30% 0.00% 10.42% NA
Intermediate  90 36.70% 47.80% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216084510 G -> DEL N N silent_mutation Average:31.087; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg1216084510 G -> T LOC_Os12g27350.1 upstream_gene_variant ; 2455.0bp to feature; MODIFIER silent_mutation Average:31.087; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg1216084510 G -> T LOC_Os12g27350-LOC_Os12g27370 intergenic_region ; MODIFIER silent_mutation Average:31.087; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216084510 NA 4.05E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 7.93E-08 mr1304 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 6.80E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 1.57E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 2.33E-07 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 4.51E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 3.00E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 6.57E-09 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 5.87E-06 mr1633 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 6.96E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 1.63E-09 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 1.30E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 6.05E-06 mr1884 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 4.12E-09 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 6.71E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 9.94E-10 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 4.63E-11 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 8.19E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 1.60E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 1.01E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 9.55E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 1.85E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 8.69E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216084510 NA 2.78E-07 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251