\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216058319:

Variant ID: vg1216058319 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 16058319
Reference Allele: AAlternative Allele: T,C,AT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, T: 0.15, C: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTGCCCTCCACTATTGGAGAAATGTTCTTTGTCCGGACGGTAAAAATCACATTAGTCCCGGTTCAAAAGTCCAATGAAACTTTATGATCTAAAGATCA[A/T,C,AT]
TTTTAGTTCCGGTTCAAAAAGTCATCAGACTGCCACTATTTTTAGTCCTGGTTGGTAACACCAACCGGGACTAAAGATGGATCTTAATCCCGTTTTTTCA

Reverse complement sequence

TGAAAAAACGGGATTAAGATCCATCTTTAGTCCCGGTTGGTGTTACCAACCAGGACTAAAAATAGTGGCAGTCTGATGACTTTTTGAACCGGAACTAAAA[T/A,G,AT]
TGATCTTTAGATCATAAAGTTTCATTGGACTTTTGAACCGGGACTAATGTGATTTTTACCGTCCGGACAAAGAACATTTCTCCAATAGTGGAGGGCACCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.70% 15.80% 0.95% 54.38% C: 0.11%; AT: 0.04%
All Indica  2759 8.00% 7.20% 1.45% 83.15% C: 0.18%
All Japonica  1512 64.10% 28.60% 0.13% 7.01% AT: 0.13%
Aus  269 18.20% 32.30% 0.00% 49.44% NA
Indica I  595 10.10% 8.10% 1.85% 80.00% NA
Indica II  465 11.60% 10.80% 1.08% 76.56% NA
Indica III  913 3.10% 6.00% 0.77% 89.59% C: 0.55%
Indica Intermediate  786 9.90% 6.00% 2.16% 81.93% NA
Temperate Japonica  767 95.60% 1.30% 0.13% 3.00% NA
Tropical Japonica  504 11.30% 75.60% 0.20% 12.50% AT: 0.40%
Japonica Intermediate  241 74.30% 17.40% 0.00% 8.30% NA
VI/Aromatic  96 82.30% 5.20% 0.00% 12.50% NA
Intermediate  90 43.30% 25.60% 3.33% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216058319 A -> C LOC_Os12g27330.1 upstream_gene_variant ; 3422.0bp to feature; MODIFIER silent_mutation Average:34.659; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058319 A -> C LOC_Os12g27335.1 upstream_gene_variant ; 3062.0bp to feature; MODIFIER silent_mutation Average:34.659; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058319 A -> C LOC_Os12g27330-LOC_Os12g27335 intergenic_region ; MODIFIER silent_mutation Average:34.659; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058319 A -> DEL N N silent_mutation Average:34.659; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058319 A -> AT LOC_Os12g27330.1 upstream_gene_variant ; 3423.0bp to feature; MODIFIER silent_mutation Average:34.659; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058319 A -> AT LOC_Os12g27335.1 upstream_gene_variant ; 3061.0bp to feature; MODIFIER silent_mutation Average:34.659; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058319 A -> AT LOC_Os12g27330-LOC_Os12g27335 intergenic_region ; MODIFIER silent_mutation Average:34.659; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058319 A -> T LOC_Os12g27330.1 upstream_gene_variant ; 3422.0bp to feature; MODIFIER silent_mutation Average:34.659; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058319 A -> T LOC_Os12g27335.1 upstream_gene_variant ; 3062.0bp to feature; MODIFIER silent_mutation Average:34.659; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058319 A -> T LOC_Os12g27330-LOC_Os12g27335 intergenic_region ; MODIFIER silent_mutation Average:34.659; most accessible tissue: Callus, score: 77.415 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216058319 8.43E-08 4.00E-18 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 1.06E-13 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 9.64E-09 5.68E-19 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 7.20E-13 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 2.97E-06 1.10E-15 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 5.63E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 4.54E-07 1.49E-16 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 4.44E-08 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 9.48E-06 4.54E-13 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 2.06E-06 7.83E-15 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 6.54E-07 7.42E-16 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 4.01E-06 NA mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 8.02E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 5.65E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 4.92E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 6.27E-06 2.12E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 4.43E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 1.76E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 1.53E-06 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 2.94E-07 3.91E-16 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 2.15E-07 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 1.80E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 5.44E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 3.21E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 2.11E-06 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 4.18E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 9.50E-06 1.16E-13 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 4.65E-06 6.37E-13 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 6.05E-07 NA mr1546 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 8.42E-09 1.12E-19 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 3.78E-09 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 3.63E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 8.79E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 3.46E-06 3.46E-06 mr1682 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 2.22E-09 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 8.49E-09 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 4.75E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 2.20E-06 9.48E-10 mr1743 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 1.04E-06 mr1743 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 1.44E-06 NA mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 9.92E-18 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 1.94E-11 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 4.64E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 6.40E-06 3.31E-19 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 4.00E-17 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 9.93E-06 2.33E-17 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 3.93E-06 4.72E-18 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 9.73E-17 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 1.17E-09 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 2.33E-15 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 6.73E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 3.27E-06 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 2.28E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 5.13E-07 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058319 NA 5.72E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251