\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216058251:

Variant ID: vg1216058251 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16058251
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, T: 0.25, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CGCTTGCAAAAAGGAAAAACGCGAAACAAAATAAAAATTACAAAAGAAAATTAACCCCGGCTTTGGCGTGGTGCCCTCCACTATTGGAGAAATGTTCTTT[G/T,A]
TCCGGACGGTAAAAATCACATTAGTCCCGGTTCAAAAGTCCAATGAAACTTTATGATCTAAAGATCAATTTTAGTTCCGGTTCAAAAAGTCATCAGACTG

Reverse complement sequence

CAGTCTGATGACTTTTTGAACCGGAACTAAAATTGATCTTTAGATCATAAAGTTTCATTGGACTTTTGAACCGGGACTAATGTGATTTTTACCGTCCGGA[C/A,T]
AAAGAACATTTCTCCAATAGTGGAGGGCACCACGCCAAAGCCGGGGTTAATTTTCTTTTGTAATTTTTATTTTGTTTCGCGTTTTTCCTTTTTGCAAGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.70% 16.00% 0.93% 54.44% A: 0.02%
All Indica  2759 7.60% 7.50% 1.52% 83.33% A: 0.04%
All Japonica  1512 64.30% 28.60% 0.07% 7.01% NA
Aus  269 19.00% 32.30% 0.00% 48.70% NA
Indica I  595 9.40% 8.40% 1.68% 80.50% NA
Indica II  465 11.80% 10.80% 1.72% 75.70% NA
Indica III  913 2.70% 6.50% 0.77% 90.03% NA
Indica Intermediate  786 9.50% 6.00% 2.16% 82.19% A: 0.13%
Temperate Japonica  767 95.60% 1.30% 0.13% 3.00% NA
Tropical Japonica  504 11.90% 75.60% 0.00% 12.50% NA
Japonica Intermediate  241 74.30% 17.40% 0.00% 8.30% NA
VI/Aromatic  96 82.30% 5.20% 0.00% 12.50% NA
Intermediate  90 45.60% 25.60% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216058251 G -> DEL N N silent_mutation Average:31.671; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058251 G -> A LOC_Os12g27330.1 upstream_gene_variant ; 3354.0bp to feature; MODIFIER silent_mutation Average:31.671; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058251 G -> A LOC_Os12g27335.1 upstream_gene_variant ; 3130.0bp to feature; MODIFIER silent_mutation Average:31.671; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058251 G -> A LOC_Os12g27330-LOC_Os12g27335 intergenic_region ; MODIFIER silent_mutation Average:31.671; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058251 G -> T LOC_Os12g27330.1 upstream_gene_variant ; 3354.0bp to feature; MODIFIER silent_mutation Average:31.671; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058251 G -> T LOC_Os12g27335.1 upstream_gene_variant ; 3130.0bp to feature; MODIFIER silent_mutation Average:31.671; most accessible tissue: Callus, score: 77.415 N N N N
vg1216058251 G -> T LOC_Os12g27330-LOC_Os12g27335 intergenic_region ; MODIFIER silent_mutation Average:31.671; most accessible tissue: Callus, score: 77.415 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216058251 NA 9.81E-13 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 6.87E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 3.04E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 1.03E-06 NA mr1217 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 3.01E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 4.61E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 1.57E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 2.53E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 9.58E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 1.32E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 6.41E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 5.21E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 2.75E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 3.01E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 4.77E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 2.59E-06 1.25E-14 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 8.10E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 9.30E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 1.44E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 9.47E-09 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 8.16E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 8.80E-09 mr1743 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 7.17E-07 NA mr1845 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 1.74E-12 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 8.52E-12 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 6.69E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 9.87E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 6.96E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 2.04E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216058251 NA 7.06E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251