Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1215903039:

Variant ID: vg1215903039 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15903039
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTTTGCAAGAGCAATAAAAAAATGTTTTATGTTAACTCCATGTATAAAGCTCTTATGTTTAATGTTGTAATACACTACTACAAAAAGGTAAATAGGTGT[C/T]
GCCACTATAGGTGCCGGTACACCAAAAAACGGCACCAATAATGCTTTCCCCGCCCATGCACCCACCTCCACACGCCACATATTAAAAAACGGCACCTTTA

Reverse complement sequence

TAAAGGTGCCGTTTTTTAATATGTGGCGTGTGGAGGTGGGTGCATGGGCGGGGAAAGCATTATTGGTGCCGTTTTTTGGTGTACCGGCACCTATAGTGGC[G/A]
ACACCTATTTACCTTTTTGTAGTAGTGTATTACAACATTAAACATAAGAGCTTTATACATGGAGTTAACATAAAACATTTTTTTATTGCTCTTGCAAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	1.60%	1.69%	5.82%	NA
All Indica	2759	95.70%	0.00%	1.38%	2.94%	NA
All Japonica	1512	81.50%	4.80%	1.72%	11.97%	NA
Aus	269	91.40%	0.00%	5.95%	2.60%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	83.40%	0.00%	6.45%	10.11%	NA
Indica III	913	97.90%	0.00%	0.22%	1.86%	NA
Indica Intermediate	786	97.10%	0.00%	0.76%	2.16%	NA
Temperate Japonica	767	96.60%	0.50%	2.61%	0.26%	NA
Tropical Japonica	504	64.30%	2.80%	0.20%	32.74%	NA
Japonica Intermediate	241	69.30%	22.80%	2.07%	5.81%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	2.20%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215903039	C -> DEL	N	N	silent_mutation	Average:25.026; most accessible tissue: Zhenshan97 root, score: 46.166	N	N	N	N
vg1215903039	C -> T	LOC_Os12g27102.1	upstream_gene_variant ; 3531.0bp to feature; MODIFIER	silent_mutation	Average:25.026; most accessible tissue: Zhenshan97 root, score: 46.166	N	N	N	N
vg1215903039	C -> T	LOC_Os12g27110.1	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:25.026; most accessible tissue: Zhenshan97 root, score: 46.166	N	N	N	N
vg1215903039	C -> T	LOC_Os12g27102.3	upstream_gene_variant ; 3531.0bp to feature; MODIFIER	silent_mutation	Average:25.026; most accessible tissue: Zhenshan97 root, score: 46.166	N	N	N	N
vg1215903039	C -> T	LOC_Os12g27110-LOC_Os12g27120	intergenic_region ; MODIFIER	silent_mutation	Average:25.026; most accessible tissue: Zhenshan97 root, score: 46.166	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215903039	2.50E-06	NA	mr1079_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215903039	NA	1.45E-06	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251