\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215903039:

Variant ID: vg1215903039 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15903039
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTTGCAAGAGCAATAAAAAAATGTTTTATGTTAACTCCATGTATAAAGCTCTTATGTTTAATGTTGTAATACACTACTACAAAAAGGTAAATAGGTGT[C/T]
GCCACTATAGGTGCCGGTACACCAAAAAACGGCACCAATAATGCTTTCCCCGCCCATGCACCCACCTCCACACGCCACATATTAAAAAACGGCACCTTTA

Reverse complement sequence

TAAAGGTGCCGTTTTTTAATATGTGGCGTGTGGAGGTGGGTGCATGGGCGGGGAAAGCATTATTGGTGCCGTTTTTTGGTGTACCGGCACCTATAGTGGC[G/A]
ACACCTATTTACCTTTTTGTAGTAGTGTATTACAACATTAAACATAAGAGCTTTATACATGGAGTTAACATAAAACATTTTTTTATTGCTCTTGCAAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 1.60% 1.69% 5.82% NA
All Indica  2759 95.70% 0.00% 1.38% 2.94% NA
All Japonica  1512 81.50% 4.80% 1.72% 11.97% NA
Aus  269 91.40% 0.00% 5.95% 2.60% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 83.40% 0.00% 6.45% 10.11% NA
Indica III  913 97.90% 0.00% 0.22% 1.86% NA
Indica Intermediate  786 97.10% 0.00% 0.76% 2.16% NA
Temperate Japonica  767 96.60% 0.50% 2.61% 0.26% NA
Tropical Japonica  504 64.30% 2.80% 0.20% 32.74% NA
Japonica Intermediate  241 69.30% 22.80% 2.07% 5.81% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 2.20% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215903039 C -> DEL N N silent_mutation Average:25.026; most accessible tissue: Zhenshan97 root, score: 46.166 N N N N
vg1215903039 C -> T LOC_Os12g27102.1 upstream_gene_variant ; 3531.0bp to feature; MODIFIER silent_mutation Average:25.026; most accessible tissue: Zhenshan97 root, score: 46.166 N N N N
vg1215903039 C -> T LOC_Os12g27110.1 upstream_gene_variant ; 1135.0bp to feature; MODIFIER silent_mutation Average:25.026; most accessible tissue: Zhenshan97 root, score: 46.166 N N N N
vg1215903039 C -> T LOC_Os12g27102.3 upstream_gene_variant ; 3531.0bp to feature; MODIFIER silent_mutation Average:25.026; most accessible tissue: Zhenshan97 root, score: 46.166 N N N N
vg1215903039 C -> T LOC_Os12g27110-LOC_Os12g27120 intergenic_region ; MODIFIER silent_mutation Average:25.026; most accessible tissue: Zhenshan97 root, score: 46.166 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215903039 2.50E-06 NA mr1079_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215903039 NA 1.45E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251