Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1215876237:

Variant ID: vg1215876237 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15876237
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGTCGATCTGGCGGTCTAAAGTGCTGACTCGTAGTCGGTAGCCTTCCTCCTCGAATCCACATCCGACGAGATCAAAGACAACGCTATGTCTCTCCTGA[C/T]
AGTATCCGTAGACACCGTAGGGGACTAGCCATGCTTATCTCTGAAGTCGATATCCAGCGTCTTGTCTTGGCGCATGTTGGCTTGTATGTTCATTTTGTGT

Reverse complement sequence

ACACAAAATGAACATACAAGCCAACATGCGCCAAGACAAGACGCTGGATATCGACTTCAGAGATAAGCATGGCTAGTCCCCTACGGTGTCTACGGATACT[G/A]
TCAGGAGAGACATAGCGTTGTCTTTGATCTCGTCGGATGTGGATTCGAGGAGGAAGGCTACCGACTACGAGTCAGCACTTTAGACCGCCAGATCGACAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.40%	7.10%	1.38%	6.18%	NA
All Indica	2759	94.60%	0.70%	0.87%	3.84%	NA
All Japonica	1512	73.10%	15.70%	1.52%	9.66%	NA
Aus	269	72.90%	7.40%	6.69%	13.01%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	80.00%	1.10%	4.09%	14.84%	NA
Indica III	913	97.90%	1.10%	0.11%	0.88%	NA
Indica Intermediate	786	95.40%	0.40%	0.51%	3.69%	NA
Temperate Japonica	767	95.80%	3.90%	0.00%	0.26%	NA
Tropical Japonica	504	34.50%	35.10%	4.17%	26.19%	NA
Japonica Intermediate	241	81.70%	12.40%	0.83%	4.98%	NA
VI/Aromatic	96	44.80%	54.20%	0.00%	1.04%	NA
Intermediate	90	86.70%	8.90%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215876237	C -> DEL	N	N	silent_mutation	Average:25.736; most accessible tissue: Zhenshan97 root, score: 59.664	N	N	N	N
vg1215876237	C -> T	LOC_Os12g27096.1	downstream_gene_variant ; 4800.0bp to feature; MODIFIER	silent_mutation	Average:25.736; most accessible tissue: Zhenshan97 root, score: 59.664	N	N	N	N
vg1215876237	C -> T	LOC_Os12g27090-LOC_Os12g27096	intergenic_region ; MODIFIER	silent_mutation	Average:25.736; most accessible tissue: Zhenshan97 root, score: 59.664	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215876237	6.77E-09	NA	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	4.44E-06	1.13E-10	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	1.49E-07	NA	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	4.22E-06	3.66E-10	mr1017	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	1.45E-09	NA	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	3.19E-06	1.58E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	4.27E-07	NA	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	NA	1.86E-09	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	NA	1.22E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	3.80E-09	NA	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	1.29E-08	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	NA	1.03E-10	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	NA	2.53E-08	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	4.27E-07	NA	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	9.44E-13	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	1.69E-08	1.64E-13	mr1132	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	2.99E-08	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	1.89E-07	NA	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	NA	3.02E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	4.32E-08	NA	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	6.61E-07	1.84E-11	mr1390	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	8.65E-11	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	6.33E-08	NA	mr1490	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	1.27E-06	2.30E-11	mr1490	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	4.53E-07	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	4.74E-10	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	3.35E-08	NA	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	3.99E-06	NA	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	1.09E-08	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	NA	1.81E-09	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	8.81E-10	NA	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	3.76E-06	NA	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	1.10E-09	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	1.78E-08	NA	mr1261_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	6.17E-14	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	5.91E-06	NA	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215876237	9.25E-10	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251