\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215815980:

Variant ID: vg1215815980 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15815980
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTCAAGATCTACTAGTTTTATTTTGGTCATTTTTCTATATAATTTTTTTCCCAACAACTTGAAATTGATTTTGACAATATAACAAATCTAATTAACAG[C/T]
ATTTGTAAATACTACATGATTTCAAATTGAAATATGGTCAAAAACAAAGTTGATCCTCTCATCAGGATCTACAACTTTTATTTTGGTCATTTGTAATAAA

Reverse complement sequence

TTTATTACAAATGACCAAAATAAAAGTTGTAGATCCTGATGAGAGGATCAACTTTGTTTTTGACCATATTTCAATTTGAAATCATGTAGTATTTACAAAT[G/A]
CTGTTAATTAGATTTGTTATATTGTCAAAATCAATTTCAAGTTGTTGGGAAAAAAATTATATAGAAAAATGACCAAAATAAAACTAGTAGATCTTGAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 31.40% 0.11% 0.00% NA
All Indica  2759 47.80% 52.00% 0.14% 0.00% NA
All Japonica  1512 97.90% 2.00% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 71.80% 28.10% 0.17% 0.00% NA
Indica II  465 50.50% 49.50% 0.00% 0.00% NA
Indica III  913 29.60% 70.40% 0.00% 0.00% NA
Indica Intermediate  786 49.40% 50.30% 0.38% 0.00% NA
Temperate Japonica  767 97.80% 2.20% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215815980 C -> T LOC_Os12g26990.1 upstream_gene_variant ; 4769.0bp to feature; MODIFIER silent_mutation Average:18.401; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1215815980 C -> T LOC_Os12g27000.1 upstream_gene_variant ; 2746.0bp to feature; MODIFIER silent_mutation Average:18.401; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1215815980 C -> T LOC_Os12g27010.1 downstream_gene_variant ; 144.0bp to feature; MODIFIER silent_mutation Average:18.401; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1215815980 C -> T LOC_Os12g27000-LOC_Os12g27010 intergenic_region ; MODIFIER silent_mutation Average:18.401; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215815980 5.59E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215815980 6.88E-07 NA mr1132_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215815980 5.15E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251