\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215706891:

Variant ID: vg1215706891 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15706891
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGGCCGCACCTCCCCCTTCGTCGCCGGCCGTCGTCGGTCGTCGTTTGGCACGAGGGTGAGTACCATTGGGTTCGCCTCGTCGTCCTCTACGTGTACATG[C/T]
CCTCCAAAGTTCCGGCCAACCGCCCTAGCTCCGGCGAGGTCGCCATCCGAGCCGGCCACCATTGATGACGTCATCGTGACATCATCATCTTTTCTTTTTC

Reverse complement sequence

GAAAAAGAAAAGATGATGATGTCACGATGACGTCATCAATGGTGGCCGGCTCGGATGGCGACCTCGCCGGAGCTAGGGCGGTTGGCCGGAACTTTGGAGG[G/A]
CATGTACACGTAGAGGACGACGAGGCGAACCCAATGGTACTCACCCTCGTGCCAAACGACGACCGACGACGGCCGGCGACGAAGGGGGAGGTGCGGCCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 16.60% 19.91% 0.02% NA
All Indica  2759 43.70% 24.60% 31.64% 0.04% NA
All Japonica  1512 98.90% 0.10% 0.93% 0.00% NA
Aus  269 49.10% 34.60% 16.36% 0.00% NA
Indica I  595 42.00% 16.10% 41.85% 0.00% NA
Indica II  465 49.70% 24.30% 25.81% 0.22% NA
Indica III  913 42.50% 29.60% 27.93% 0.00% NA
Indica Intermediate  786 42.90% 25.40% 31.68% 0.00% NA
Temperate Japonica  767 99.60% 0.00% 0.39% 0.00% NA
Tropical Japonica  504 99.00% 0.40% 0.60% 0.00% NA
Japonica Intermediate  241 96.70% 0.00% 3.32% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 81.10% 7.80% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215706891 C -> DEL N N silent_mutation Average:39.886; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg1215706891 C -> T LOC_Os12g26820.1 upstream_gene_variant ; 3435.0bp to feature; MODIFIER silent_mutation Average:39.886; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg1215706891 C -> T LOC_Os12g26810.1 downstream_gene_variant ; 979.0bp to feature; MODIFIER silent_mutation Average:39.886; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg1215706891 C -> T LOC_Os12g26810-LOC_Os12g26820 intergenic_region ; MODIFIER silent_mutation Average:39.886; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1215706891 C T 0.0 0.01 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215706891 NA 2.62E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 1.13E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 4.32E-28 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 2.16E-34 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 1.54E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 3.44E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 1.04E-08 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 1.27E-07 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 1.62E-06 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 1.01E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 6.28E-06 5.17E-37 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 1.17E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 5.54E-06 NA mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 3.87E-06 NA mr1346_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 4.15E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 1.32E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 4.93E-07 5.63E-09 mr1577_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 3.21E-06 1.25E-07 mr1577_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 2.91E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 1.28E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 5.33E-06 NA mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215706891 NA 2.37E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251