\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215659438:

Variant ID: vg1215659438 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15659438
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGGCTCCACACATGGGCACATGCGAGCCTAACACCTGCGGTCTACTGACATGGCCCACTCGATCAAGGGCACATACGGGACTCGCACCCGCAGTCCACA[A/G]
GGCTTCATTGGTATAGCACCCGAGTGTGCACGGCACTAGAGATTGCAAACTTGGCTCTGATATCACTTGTTACAAAATCGGCACCGAAATCACATCAGTG

Reverse complement sequence

CACTGATGTGATTTCGGTGCCGATTTTGTAACAAGTGATATCAGAGCCAAGTTTGCAATCTCTAGTGCCGTGCACACTCGGGTGCTATACCAATGAAGCC[T/C]
TGTGGACTGCGGGTGCGAGTCCCGTATGTGCCCTTGATCGAGTGGGCCATGTCAGTAGACCGCAGGTGTTAGGCTCGCATGTGCCCATGTGTGGAGCCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 6.00% 0.55% 41.09% NA
All Indica  2759 42.70% 2.10% 0.80% 54.44% NA
All Japonica  1512 69.40% 8.40% 0.07% 22.09% NA
Aus  269 59.10% 31.60% 0.00% 9.29% NA
Indica I  595 82.50% 0.80% 0.50% 16.13% NA
Indica II  465 35.10% 0.20% 0.65% 64.09% NA
Indica III  913 19.40% 2.70% 0.77% 77.11% NA
Indica Intermediate  786 44.10% 3.30% 1.15% 51.40% NA
Temperate Japonica  767 94.40% 0.30% 0.00% 5.35% NA
Tropical Japonica  504 31.00% 24.00% 0.20% 44.84% NA
Japonica Intermediate  241 70.50% 1.70% 0.00% 27.80% NA
VI/Aromatic  96 38.50% 1.00% 0.00% 60.42% NA
Intermediate  90 56.70% 14.40% 3.33% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215659438 A -> DEL N N silent_mutation Average:27.801; most accessible tissue: Callus, score: 61.41 N N N N
vg1215659438 A -> G LOC_Os12g26710.1 downstream_gene_variant ; 3963.0bp to feature; MODIFIER silent_mutation Average:27.801; most accessible tissue: Callus, score: 61.41 N N N N
vg1215659438 A -> G LOC_Os12g26720.1 downstream_gene_variant ; 2616.0bp to feature; MODIFIER silent_mutation Average:27.801; most accessible tissue: Callus, score: 61.41 N N N N
vg1215659438 A -> G LOC_Os12g26710-LOC_Os12g26720 intergenic_region ; MODIFIER silent_mutation Average:27.801; most accessible tissue: Callus, score: 61.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215659438 2.37E-08 NA mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 1.25E-07 NA mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 5.45E-07 NA mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 2.03E-06 NA mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 1.18E-09 NA mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 NA 2.04E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 1.76E-07 NA mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 NA 1.21E-08 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 NA 5.86E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 NA 2.91E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 5.60E-08 NA mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 4.44E-07 2.82E-09 mr1417 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 NA 3.03E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 1.17E-07 NA mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 NA 1.65E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 2.61E-06 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 1.19E-06 NA mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 7.47E-07 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 1.74E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 3.18E-11 NA mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 NA 6.18E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 6.11E-08 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 1.12E-10 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 5.46E-06 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 1.51E-07 NA mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 NA 1.51E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 7.96E-11 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438 4.44E-11 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251