Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215659438:

Variant ID: vg1215659438 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15659438
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGGCTCCACACATGGGCACATGCGAGCCTAACACCTGCGGTCTACTGACATGGCCCACTCGATCAAGGGCACATACGGGACTCGCACCCGCAGTCCACA[A/G]
GGCTTCATTGGTATAGCACCCGAGTGTGCACGGCACTAGAGATTGCAAACTTGGCTCTGATATCACTTGTTACAAAATCGGCACCGAAATCACATCAGTG

Reverse complement sequence

CACTGATGTGATTTCGGTGCCGATTTTGTAACAAGTGATATCAGAGCCAAGTTTGCAATCTCTAGTGCCGTGCACACTCGGGTGCTATACCAATGAAGCC[T/C]
TGTGGACTGCGGGTGCGAGTCCCGTATGTGCCCTTGATCGAGTGGGCCATGTCAGTAGACCGCAGGTGTTAGGCTCGCATGTGCCCATGTGTGGAGCCGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.40%	6.00%	0.55%	41.09%	NA
All Indica	2759	42.70%	2.10%	0.80%	54.44%	NA
All Japonica	1512	69.40%	8.40%	0.07%	22.09%	NA
Aus	269	59.10%	31.60%	0.00%	9.29%	NA
Indica I	595	82.50%	0.80%	0.50%	16.13%	NA
Indica II	465	35.10%	0.20%	0.65%	64.09%	NA
Indica III	913	19.40%	2.70%	0.77%	77.11%	NA
Indica Intermediate	786	44.10%	3.30%	1.15%	51.40%	NA
Temperate Japonica	767	94.40%	0.30%	0.00%	5.35%	NA
Tropical Japonica	504	31.00%	24.00%	0.20%	44.84%	NA
Japonica Intermediate	241	70.50%	1.70%	0.00%	27.80%	NA
VI/Aromatic	96	38.50%	1.00%	0.00%	60.42%	NA
Intermediate	90	56.70%	14.40%	3.33%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215659438	A -> DEL	N	N	silent_mutation	Average:27.801; most accessible tissue: Callus, score: 61.41	N	N	N	N
vg1215659438	A -> G	LOC_Os12g26710.1	downstream_gene_variant ; 3963.0bp to feature; MODIFIER	silent_mutation	Average:27.801; most accessible tissue: Callus, score: 61.41	N	N	N	N
vg1215659438	A -> G	LOC_Os12g26720.1	downstream_gene_variant ; 2616.0bp to feature; MODIFIER	silent_mutation	Average:27.801; most accessible tissue: Callus, score: 61.41	N	N	N	N
vg1215659438	A -> G	LOC_Os12g26710-LOC_Os12g26720	intergenic_region ; MODIFIER	silent_mutation	Average:27.801; most accessible tissue: Callus, score: 61.41	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215659438	2.37E-08	NA	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	1.25E-07	NA	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	5.45E-07	NA	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	2.03E-06	NA	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	1.18E-09	NA	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	NA	2.04E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	1.76E-07	NA	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	NA	1.21E-08	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	NA	5.86E-06	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	NA	2.91E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	5.60E-08	NA	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	4.44E-07	2.82E-09	mr1417	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	NA	3.03E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	1.17E-07	NA	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	NA	1.65E-06	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	2.61E-06	NA	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	1.19E-06	NA	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	7.47E-07	NA	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	1.74E-06	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	3.18E-11	NA	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	NA	6.18E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	6.11E-08	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	1.12E-10	NA	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	5.46E-06	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	1.51E-07	NA	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	NA	1.51E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	7.96E-11	NA	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215659438	4.44E-11	NA	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251