\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215646445:

Variant ID: vg1215646445 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15646445
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTGAGATCTACATGTTAAAAATATCCACATGTACTGTTTATGCTTGTCTTTGTACTGTTTTGTTGATTTTGTTCATTTGCTTTAGTTTTCGATGTTC[C/T]
GGAGGAGAGCGTTTACGTTGAGGAGGGTTCTGAAGTATTTGAAGAAGCACAAGGTAAGTCACACAGATCCCAAACAACCCTTTGAGCTTGTTGAACCCAT

Reverse complement sequence

ATGGGTTCAACAAGCTCAAAGGGTTGTTTGGGATCTGTGTGACTTACCTTGTGCTTCTTCAAATACTTCAGAACCCTCCTCAACGTAAACGCTCTCCTCC[G/A]
GAACATCGAAAACTAAAGCAAATGAACAAAATCAACAAAACAGTACAAAGACAAGCATAAACAGTACATGTGGATATTTTTAACATGTAGATCTCAATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.00% 14.60% 0.42% 58.04% NA
All Indica  2759 6.10% 7.00% 0.62% 86.30% NA
All Japonica  1512 68.10% 20.90% 0.07% 10.98% NA
Aus  269 10.80% 37.50% 0.00% 51.67% NA
Indica I  595 9.10% 0.30% 1.01% 89.58% NA
Indica II  465 6.70% 26.70% 0.43% 66.24% NA
Indica III  913 1.20% 2.40% 0.44% 95.95% NA
Indica Intermediate  786 9.00% 5.90% 0.64% 84.48% NA
Temperate Japonica  767 91.80% 4.20% 0.13% 3.91% NA
Tropical Japonica  504 34.70% 45.20% 0.00% 20.04% NA
Japonica Intermediate  241 62.20% 23.20% 0.00% 14.52% NA
VI/Aromatic  96 10.40% 61.50% 0.00% 28.12% NA
Intermediate  90 44.40% 20.00% 2.22% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215646445 C -> DEL LOC_Os12g26700.1 N frameshift_variant Average:22.797; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg1215646445 C -> T LOC_Os12g26700.1 missense_variant ; p.Arg90Trp; MODERATE stop_gained Average:22.797; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg1215646445 C -> T LOC_Os12g26700.1 missense_variant ; p.Arg90Trp; MODERATE nonsynonymous_codon ; R90W Average:22.797; most accessible tissue: Minghui63 flag leaf, score: 39.69 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215646445 NA 7.75E-10 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 NA 5.35E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 NA 4.19E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 NA 3.16E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 NA 1.03E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 NA 1.20E-08 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 NA 2.13E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 NA 6.51E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 2.09E-06 1.75E-14 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 1.98E-07 3.41E-13 mr1023_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 3.52E-09 7.29E-16 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 2.24E-07 6.43E-14 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 2.88E-08 1.04E-13 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 NA 8.96E-14 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 2.49E-09 3.63E-16 mr1390_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 1.39E-08 6.77E-11 mr1489_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215646445 5.71E-09 1.80E-15 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251