\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215630177:

Variant ID: vg1215630177 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15630177
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTTTTAGATCTTGATGAGTTATTCAACTTTGTTGTTGATGACATTTTTAGTTGATATCATTTAGTATTTGAAAATGTTGTTTGAAGTTGTCATATTTT[T/C]
AAATTCAAATTCAAATGGTTCAAAAAATGTTATATAGAAAAATGACTAAAATGAAAGTTATAGATTTTGATGAGTTATACAACTTTGTTGTTGATGACTT

Reverse complement sequence

AAGTCATCAACAACAAAGTTGTATAACTCATCAAAATCTATAACTTTCATTTTAGTCATTTTTCTATATAACATTTTTTGAACCATTTGAATTTGAATTT[A/G]
AAAATATGACAACTTCAAACAACATTTTCAAATACTAAATGATATCAACTAAAAATGTCATCAACAACAAAGTTGAATAACTCATCAAGATCTAAAACTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.70% 0.20% 21.71% 38.40% NA
All Indica  2759 17.10% 0.40% 30.16% 52.30% NA
All Japonica  1512 81.90% 0.00% 1.79% 16.27% NA
Aus  269 17.80% 0.00% 52.42% 29.74% NA
Indica I  595 13.30% 0.30% 13.28% 73.11% NA
Indica II  465 35.30% 0.20% 21.08% 43.44% NA
Indica III  913 9.30% 0.50% 45.35% 44.80% NA
Indica Intermediate  786 18.40% 0.40% 30.66% 50.51% NA
Temperate Japonica  767 93.20% 0.00% 0.26% 6.52% NA
Tropical Japonica  504 66.70% 0.00% 4.17% 29.17% NA
Japonica Intermediate  241 78.00% 0.00% 1.66% 20.33% NA
VI/Aromatic  96 61.50% 0.00% 12.50% 26.04% NA
Intermediate  90 61.10% 0.00% 15.56% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215630177 T -> C LOC_Os12g26660.1 downstream_gene_variant ; 1312.0bp to feature; MODIFIER silent_mutation Average:6.809; most accessible tissue: Callus, score: 15.485 N N N N
vg1215630177 T -> C LOC_Os12g26670.1 downstream_gene_variant ; 1428.0bp to feature; MODIFIER silent_mutation Average:6.809; most accessible tissue: Callus, score: 15.485 N N N N
vg1215630177 T -> C LOC_Os12g26660-LOC_Os12g26670 intergenic_region ; MODIFIER silent_mutation Average:6.809; most accessible tissue: Callus, score: 15.485 N N N N
vg1215630177 T -> DEL N N silent_mutation Average:6.809; most accessible tissue: Callus, score: 15.485 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215630177 NA 1.68E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177 NA 4.94E-06 mr1654 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177 NA 3.28E-12 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177 5.27E-06 NA mr1193_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177 3.48E-06 3.35E-08 mr1193_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177 NA 1.21E-12 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177 NA 1.84E-11 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177 NA 1.02E-07 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177 NA 2.48E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251