Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1215630177:

Variant ID: vg1215630177 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15630177
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGTTTTAGATCTTGATGAGTTATTCAACTTTGTTGTTGATGACATTTTTAGTTGATATCATTTAGTATTTGAAAATGTTGTTTGAAGTTGTCATATTTT[T/C]
AAATTCAAATTCAAATGGTTCAAAAAATGTTATATAGAAAAATGACTAAAATGAAAGTTATAGATTTTGATGAGTTATACAACTTTGTTGTTGATGACTT

Reverse complement sequence

AAGTCATCAACAACAAAGTTGTATAACTCATCAAAATCTATAACTTTCATTTTAGTCATTTTTCTATATAACATTTTTTGAACCATTTGAATTTGAATTT[A/G]
AAAATATGACAACTTCAAACAACATTTTCAAATACTAAATGATATCAACTAAAAATGTCATCAACAACAAAGTTGAATAACTCATCAAGATCTAAAACTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.70%	0.20%	21.71%	38.40%	NA
All Indica	2759	17.10%	0.40%	30.16%	52.30%	NA
All Japonica	1512	81.90%	0.00%	1.79%	16.27%	NA
Aus	269	17.80%	0.00%	52.42%	29.74%	NA
Indica I	595	13.30%	0.30%	13.28%	73.11%	NA
Indica II	465	35.30%	0.20%	21.08%	43.44%	NA
Indica III	913	9.30%	0.50%	45.35%	44.80%	NA
Indica Intermediate	786	18.40%	0.40%	30.66%	50.51%	NA
Temperate Japonica	767	93.20%	0.00%	0.26%	6.52%	NA
Tropical Japonica	504	66.70%	0.00%	4.17%	29.17%	NA
Japonica Intermediate	241	78.00%	0.00%	1.66%	20.33%	NA
VI/Aromatic	96	61.50%	0.00%	12.50%	26.04%	NA
Intermediate	90	61.10%	0.00%	15.56%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215630177	T -> C	LOC_Os12g26660.1	downstream_gene_variant ; 1312.0bp to feature; MODIFIER	silent_mutation	Average:6.809; most accessible tissue: Callus, score: 15.485	N	N	N	N
vg1215630177	T -> C	LOC_Os12g26670.1	downstream_gene_variant ; 1428.0bp to feature; MODIFIER	silent_mutation	Average:6.809; most accessible tissue: Callus, score: 15.485	N	N	N	N
vg1215630177	T -> C	LOC_Os12g26660-LOC_Os12g26670	intergenic_region ; MODIFIER	silent_mutation	Average:6.809; most accessible tissue: Callus, score: 15.485	N	N	N	N
vg1215630177	T -> DEL	N	N	silent_mutation	Average:6.809; most accessible tissue: Callus, score: 15.485	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215630177	NA	1.68E-09	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177	NA	4.94E-06	mr1654	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177	NA	3.28E-12	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177	5.27E-06	NA	mr1193_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177	3.48E-06	3.35E-08	mr1193_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177	NA	1.21E-12	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177	NA	1.84E-11	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177	NA	1.02E-07	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215630177	NA	2.48E-06	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251