\
| Variant ID: vg1215630177 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15630177 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAGTTTTAGATCTTGATGAGTTATTCAACTTTGTTGTTGATGACATTTTTAGTTGATATCATTTAGTATTTGAAAATGTTGTTTGAAGTTGTCATATTTT[T/C]
AAATTCAAATTCAAATGGTTCAAAAAATGTTATATAGAAAAATGACTAAAATGAAAGTTATAGATTTTGATGAGTTATACAACTTTGTTGTTGATGACTT
AAGTCATCAACAACAAAGTTGTATAACTCATCAAAATCTATAACTTTCATTTTAGTCATTTTTCTATATAACATTTTTTGAACCATTTGAATTTGAATTT[A/G]
AAAATATGACAACTTCAAACAACATTTTCAAATACTAAATGATATCAACTAAAAATGTCATCAACAACAAAGTTGAATAACTCATCAAGATCTAAAACTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 0.20% | 21.71% | 38.40% | NA |
| All Indica | 2759 | 17.10% | 0.40% | 30.16% | 52.30% | NA |
| All Japonica | 1512 | 81.90% | 0.00% | 1.79% | 16.27% | NA |
| Aus | 269 | 17.80% | 0.00% | 52.42% | 29.74% | NA |
| Indica I | 595 | 13.30% | 0.30% | 13.28% | 73.11% | NA |
| Indica II | 465 | 35.30% | 0.20% | 21.08% | 43.44% | NA |
| Indica III | 913 | 9.30% | 0.50% | 45.35% | 44.80% | NA |
| Indica Intermediate | 786 | 18.40% | 0.40% | 30.66% | 50.51% | NA |
| Temperate Japonica | 767 | 93.20% | 0.00% | 0.26% | 6.52% | NA |
| Tropical Japonica | 504 | 66.70% | 0.00% | 4.17% | 29.17% | NA |
| Japonica Intermediate | 241 | 78.00% | 0.00% | 1.66% | 20.33% | NA |
| VI/Aromatic | 96 | 61.50% | 0.00% | 12.50% | 26.04% | NA |
| Intermediate | 90 | 61.10% | 0.00% | 15.56% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215630177 | T -> C | LOC_Os12g26660.1 | downstream_gene_variant ; 1312.0bp to feature; MODIFIER | silent_mutation | Average:6.809; most accessible tissue: Callus, score: 15.485 | N | N | N | N |
| vg1215630177 | T -> C | LOC_Os12g26670.1 | downstream_gene_variant ; 1428.0bp to feature; MODIFIER | silent_mutation | Average:6.809; most accessible tissue: Callus, score: 15.485 | N | N | N | N |
| vg1215630177 | T -> C | LOC_Os12g26660-LOC_Os12g26670 | intergenic_region ; MODIFIER | silent_mutation | Average:6.809; most accessible tissue: Callus, score: 15.485 | N | N | N | N |
| vg1215630177 | T -> DEL | N | N | silent_mutation | Average:6.809; most accessible tissue: Callus, score: 15.485 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215630177 | NA | 1.68E-09 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215630177 | NA | 4.94E-06 | mr1654 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215630177 | NA | 3.28E-12 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215630177 | 5.27E-06 | NA | mr1193_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215630177 | 3.48E-06 | 3.35E-08 | mr1193_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215630177 | NA | 1.21E-12 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215630177 | NA | 1.84E-11 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215630177 | NA | 1.02E-07 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215630177 | NA | 2.48E-06 | mr1803_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |