\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215629389:

Variant ID: vg1215629389 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15629389
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTTAGAAATAGCGGGCCGTCACAAGGAAGTCATCTCAATCGGGCCGAAAAGTGCCCGATTGAGATATGGTCGCACAGACATGTTAGATGGGTATAAAA[T/C]
TTAACCCCGTCACGGTTGACACCTATCAGTGATGGGCCACAACTTTAGGCCCGATTAAGAAAACATTCCATATCTCAAACGGGCCTAAAGTTGTGGCCCG

Reverse complement sequence

CGGGCCACAACTTTAGGCCCGTTTGAGATATGGAATGTTTTCTTAATCGGGCCTAAAGTTGTGGCCCATCACTGATAGGTGTCAACCGTGACGGGGTTAA[A/G]
TTTTATACCCATCTAACATGTCTGTGCGACCATATCTCAATCGGGCACTTTTCGGCCCGATTGAGATGACTTCCTTGTGACGGCCCGCTATTTCTAAGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.40% 17.80% 0.44% 58.29% NA
All Indica  2759 5.30% 7.50% 0.62% 86.59% NA
All Japonica  1512 59.70% 29.20% 0.00% 11.11% NA
Aus  269 7.80% 39.80% 0.00% 52.42% NA
Indica I  595 9.20% 0.50% 1.01% 89.24% NA
Indica II  465 4.30% 28.00% 0.43% 67.31% NA
Indica III  913 1.30% 2.50% 0.33% 95.84% NA
Indica Intermediate  786 7.60% 6.40% 0.76% 85.24% NA
Temperate Japonica  767 91.50% 4.40% 0.00% 4.04% NA
Tropical Japonica  504 10.50% 69.20% 0.00% 20.24% NA
Japonica Intermediate  241 61.00% 24.50% 0.00% 14.52% NA
VI/Aromatic  96 10.40% 61.50% 0.00% 28.12% NA
Intermediate  90 30.00% 32.20% 4.44% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215629389 T -> C LOC_Os12g26660.1 downstream_gene_variant ; 524.0bp to feature; MODIFIER silent_mutation Average:16.333; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1215629389 T -> C LOC_Os12g26670.1 downstream_gene_variant ; 2216.0bp to feature; MODIFIER silent_mutation Average:16.333; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1215629389 T -> C LOC_Os12g26660-LOC_Os12g26670 intergenic_region ; MODIFIER silent_mutation Average:16.333; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1215629389 T -> DEL N N silent_mutation Average:16.333; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215629389 NA 3.27E-12 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 7.05E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 8.18E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 2.65E-12 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 3.21E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 4.25E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 2.36E-12 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 9.99E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 1.48E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 3.14E-06 mr1633 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 2.33E-07 1.86E-16 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 3.35E-12 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 2.82E-08 3.78E-16 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 5.86E-09 1.09E-16 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 3.36E-07 2.71E-14 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 3.75E-14 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 2.62E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 2.92E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 5.58E-09 2.95E-18 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 2.87E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 1.42E-09 6.38E-18 mr1490_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215629389 NA 1.94E-11 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251