\
| Variant ID: vg1215612687 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15612687 |
| Reference Allele: A | Alternative Allele: C,G |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, C: 0.38, G: 0.04, others allele: 0.00, population size: 74. )
TCAGAAGTCGCTGCTCCTTTGCACATTCAACGATGACATCCGCCGGAACAAATTATTGGTAATATAGGTAAGCGGACTACAAGGTCTAAGGTAACGACTC[A/C,G]
TGATGTTTGTGCAAATTCTGCATTTCTTGCTTCTTTTGAACCCAAAGATGTGTCACATGCATTAACTGATGAATCGTGGATTAACGCCATGCATGAAGAA
TTCTTCATGCATGGCGTTAATCCACGATTCATCAGTTAATGCATGTGACACATCTTTGGGTTCAAAAGAAGCAAGAAATGCAGAATTTGCACAAACATCA[T/G,C]
GAGTCGTTACCTTAGACCTTGTAGTCCGCTTACCTATATTACCAATAATTTGTTCCGGCGGATGTCATCGTTGAATGTGCAAAGGAGCAGCGACTTCTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.90% | 31.30% | 0.17% | 9.54% | G: 0.08% |
| All Indica | 2759 | 45.30% | 52.00% | 0.25% | 2.25% | G: 0.14% |
| All Japonica | 1512 | 78.40% | 1.50% | 0.00% | 20.11% | NA |
| Aus | 269 | 90.70% | 0.70% | 0.00% | 8.55% | NA |
| Indica I | 595 | 28.70% | 70.40% | 0.67% | 0.00% | G: 0.17% |
| Indica II | 465 | 32.00% | 58.50% | 0.00% | 9.46% | NA |
| Indica III | 913 | 63.90% | 35.00% | 0.22% | 0.88% | NA |
| Indica Intermediate | 786 | 44.10% | 54.10% | 0.13% | 1.27% | G: 0.38% |
| Temperate Japonica | 767 | 94.70% | 1.20% | 0.00% | 4.17% | NA |
| Tropical Japonica | 504 | 54.00% | 2.00% | 0.00% | 44.05% | NA |
| Japonica Intermediate | 241 | 77.60% | 1.70% | 0.00% | 20.75% | NA |
| VI/Aromatic | 96 | 41.70% | 1.00% | 1.04% | 56.25% | NA |
| Intermediate | 90 | 71.10% | 20.00% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215612687 | A -> C | LOC_Os12g26650.1 | missense_variant ; p.His38Pro; MODERATE | nonsynonymous_codon ; H38P | Average:9.038; most accessible tissue: Zhenshan97 flower, score: 20.672 | benign |
0.073 |
TOLERATED | 0.07 |
| vg1215612687 | A -> DEL | LOC_Os12g26650.1 | N | frameshift_variant | Average:9.038; most accessible tissue: Zhenshan97 flower, score: 20.672 | N | N | N | N |
| vg1215612687 | A -> G | LOC_Os12g26650.1 | missense_variant ; p.His38Arg; MODERATE | nonsynonymous_codon ; H38R | Average:9.038; most accessible tissue: Zhenshan97 flower, score: 20.672 | possibly damaging |
1.601 |
TOLERATED | 0.37 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215612687 | NA | 1.22E-06 | mr1330 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215612687 | NA | 9.39E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215612687 | NA | 3.36E-06 | mr1438 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215612687 | 1.89E-06 | 7.01E-07 | mr1579 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215612687 | NA | 5.66E-10 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215612687 | NA | 7.09E-06 | mr1610 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215612687 | NA | 9.75E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215612687 | NA | 1.63E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215612687 | NA | 2.39E-06 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |