\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215546652:

Variant ID: vg1215546652 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15546652
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.29, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTACAATTAAGCTTGAATCAACAATCAAAATTCATGATTTCATACGATTTATAATGCAACATCTTAACAAGCACATAGGTTGAAGAATAAACACTAAA[T/C]
ACGTATACCTATTGCATTTATCACTCTTTCTCAAATAACCTTTAGCACAAAATAACCAAGAGAATTTTTTTTCAACCTTTTCTTTTTTTGAGCCTTTTTG

Reverse complement sequence

CAAAAAGGCTCAAAAAAAGAAAAGGTTGAAAAAAAATTCTCTTGGTTATTTTGTGCTAAAGGTTATTTGAGAAAGAGTGATAAATGCAATAGGTATACGT[A/G]
TTTAGTGTTTATTCTTCAACCTATGTGCTTGTTAAGATGTTGCATTATAAATCGTATGAAATCATGAATTTTGATTGTTGATTCAAGCTTAATTGTAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.20% 2.20% 51.06% 23.49% NA
All Indica  2759 3.80% 2.40% 68.07% 25.81% NA
All Japonica  1512 61.40% 0.80% 17.59% 20.24% NA
Aus  269 8.90% 9.70% 73.61% 7.81% NA
Indica I  595 3.00% 0.80% 47.23% 48.91% NA
Indica II  465 6.00% 0.60% 60.86% 32.47% NA
Indica III  913 1.10% 3.90% 87.40% 7.56% NA
Indica Intermediate  786 6.10% 2.70% 65.65% 25.57% NA
Temperate Japonica  767 92.40% 0.30% 3.13% 4.17% NA
Tropical Japonica  504 13.30% 1.80% 39.68% 45.24% NA
Japonica Intermediate  241 63.10% 0.40% 17.43% 19.09% NA
VI/Aromatic  96 12.50% 2.10% 31.25% 54.17% NA
Intermediate  90 32.20% 1.10% 45.56% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215546652 T -> C LOC_Os12g26570.1 downstream_gene_variant ; 627.0bp to feature; MODIFIER silent_mutation Average:7.554; most accessible tissue: Zhenshan97 root, score: 15.132 N N N N
vg1215546652 T -> C LOC_Os12g26580.1 downstream_gene_variant ; 4653.0bp to feature; MODIFIER silent_mutation Average:7.554; most accessible tissue: Zhenshan97 root, score: 15.132 N N N N
vg1215546652 T -> C LOC_Os12g26560-LOC_Os12g26570 intergenic_region ; MODIFIER silent_mutation Average:7.554; most accessible tissue: Zhenshan97 root, score: 15.132 N N N N
vg1215546652 T -> DEL N N silent_mutation Average:7.554; most accessible tissue: Zhenshan97 root, score: 15.132 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215546652 NA 1.57E-36 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 9.37E-31 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 6.13E-08 4.25E-60 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 6.55E-10 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 8.46E-36 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 6.91E-08 2.27E-50 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 5.33E-06 2.10E-13 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 2.89E-07 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 6.61E-06 1.54E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 6.77E-07 1.26E-60 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 4.01E-11 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 9.91E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 2.65E-08 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 3.08E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 5.90E-07 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 6.08E-13 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 1.94E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 5.16E-06 8.89E-09 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 9.84E-07 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 6.54E-13 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 4.11E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 4.67E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 1.98E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 3.91E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 7.16E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 6.99E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 2.40E-08 mr1606 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 3.30E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 6.45E-41 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 1.23E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215546652 NA 3.56E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251