\
| Variant ID: vg1215515938 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15515938 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 94. )
AGACATAAACATCTTGCAAACTAAGTCATGTGATAATCTTGCTGATTTATTCACAAAATCTCTACCATACTCCACATTCTTTAAATGTGTCGAAGGAATT[G/T]
GTATGAGACGACTTAAAAATATCTTCCTCTGGAAAATAACCTATTTTCGTCATATTATACTCTTTTTCCTTTGTATCAGTTTTACCCTTTAGGTTTTCTC
GAGAAAACCTAAAGGGTAAAACTGATACAAAGGAAAAAGAGTATAATATGACGAAAATAGGTTATTTTCCAGAGGAAGATATTTTTAAGTCGTCTCATAC[C/A]
AATTCCTTCGACACATTTAAAGAATGTGGAGTATGGTAGAGATTTTGTGAATAAATCAGCAAGATTATCACATGACTTAGTTTGCAAGATGTTTATGTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.80% | 41.90% | 0.44% | 14.92% | NA |
| All Indica | 2759 | 25.20% | 68.90% | 0.47% | 5.44% | NA |
| All Japonica | 1512 | 70.80% | 2.80% | 0.26% | 26.19% | NA |
| Aus | 269 | 62.80% | 1.10% | 1.49% | 34.57% | NA |
| Indica I | 595 | 7.60% | 92.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 56.10% | 21.70% | 1.51% | 20.65% | NA |
| Indica III | 913 | 17.40% | 80.70% | 0.00% | 1.86% | NA |
| Indica Intermediate | 786 | 29.40% | 65.40% | 0.51% | 4.71% | NA |
| Temperate Japonica | 767 | 95.30% | 1.40% | 0.00% | 3.26% | NA |
| Tropical Japonica | 504 | 32.90% | 2.40% | 0.60% | 64.09% | NA |
| Japonica Intermediate | 241 | 71.80% | 7.90% | 0.41% | 19.92% | NA |
| VI/Aromatic | 96 | 40.60% | 6.20% | 0.00% | 53.12% | NA |
| Intermediate | 90 | 53.30% | 30.00% | 0.00% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215515938 | G -> DEL | N | N | silent_mutation | Average:12.083; most accessible tissue: Zhenshan97 flag leaf, score: 21.009 | N | N | N | N |
| vg1215515938 | G -> T | LOC_Os12g26540.1 | downstream_gene_variant ; 3776.0bp to feature; MODIFIER | silent_mutation | Average:12.083; most accessible tissue: Zhenshan97 flag leaf, score: 21.009 | N | N | N | N |
| vg1215515938 | G -> T | LOC_Os12g26540-LOC_Os12g26560 | intergenic_region ; MODIFIER | silent_mutation | Average:12.083; most accessible tissue: Zhenshan97 flag leaf, score: 21.009 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215515938 | 8.61E-06 | NA | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | 3.36E-06 | NA | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | NA | 8.14E-14 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | NA | 5.66E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | 1.89E-06 | NA | mr1022_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | NA | 7.99E-09 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | NA | 1.59E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | NA | 6.63E-07 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | 7.02E-06 | NA | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | NA | 2.97E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | NA | 1.65E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | NA | 6.73E-11 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215515938 | NA | 1.51E-08 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |