Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215438530:

Variant ID: vg1215438530 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15438530
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAGTAGTGTTCGTCAAGTTGTGTGAAACAGATTTTCTAATATCTATGTCCGGATTATGTCAAAACGGTTGGACTAATACGGGCCAATGTATTTCTTTTG[G/A]
TCAATTTGAATAGACATCACCGATTAATAAAAAAAACCAGAAAAAAGAGGGAAATCAAACAGAGCAAGATCGAGCCAGAGGCCTAGCTATGGAAATACAA

Reverse complement sequence

TTGTATTTCCATAGCTAGGCCTCTGGCTCGATCTTGCTCTGTTTGATTTCCCTCTTTTTTCTGGTTTTTTTTATTAATCGGTGATGTCTATTCAAATTGA[C/T]
CAAAAGAAATACATTGGCCCGTATTAGTCCAACCGTTTTGACATAATCCGGACATAGATATTAGAAAATCTGTTTCACACAACTTGACGAACACTACTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	5.40%	7.91%	27.00%	NA
All Indica	2759	63.60%	1.30%	10.29%	24.79%	NA
All Japonica	1512	62.70%	8.50%	2.25%	26.59%	NA
Aus	269	15.60%	30.10%	15.99%	38.29%	NA
Indica I	595	84.50%	0.20%	3.53%	11.76%	NA
Indica II	465	67.30%	0.20%	4.95%	27.53%	NA
Indica III	913	43.50%	1.40%	18.07%	37.02%	NA
Indica Intermediate	786	69.10%	2.50%	9.54%	18.83%	NA
Temperate Japonica	767	92.70%	0.30%	0.65%	6.39%	NA
Tropical Japonica	504	15.70%	24.20%	3.17%	56.94%	NA
Japonica Intermediate	241	65.60%	1.70%	5.39%	27.39%	NA
VI/Aromatic	96	20.80%	3.10%	5.21%	70.83%	NA
Intermediate	90	58.90%	11.10%	8.89%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215438530	G -> DEL	N	N	silent_mutation	Average:23.975; most accessible tissue: Callus, score: 68.271	N	N	N	N
vg1215438530	G -> A	LOC_Os12g26410.1	upstream_gene_variant ; 4051.0bp to feature; MODIFIER	silent_mutation	Average:23.975; most accessible tissue: Callus, score: 68.271	N	N	N	N
vg1215438530	G -> A	LOC_Os12g26420.1	downstream_gene_variant ; 1830.0bp to feature; MODIFIER	silent_mutation	Average:23.975; most accessible tissue: Callus, score: 68.271	N	N	N	N
vg1215438530	G -> A	LOC_Os12g26410-LOC_Os12g26420	intergenic_region ; MODIFIER	silent_mutation	Average:23.975; most accessible tissue: Callus, score: 68.271	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215438530	NA	3.25E-08	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	3.53E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	1.11E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	2.25E-06	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	9.27E-06	mr1398	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	7.39E-06	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	6.45E-06	NA	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	9.51E-06	3.99E-10	mr1551	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	5.92E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	9.85E-08	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	7.21E-09	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	7.26E-06	mr1695	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	9.49E-08	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	5.39E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	2.64E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530	NA	1.43E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251