\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215438530:

Variant ID: vg1215438530 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15438530
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAGTAGTGTTCGTCAAGTTGTGTGAAACAGATTTTCTAATATCTATGTCCGGATTATGTCAAAACGGTTGGACTAATACGGGCCAATGTATTTCTTTTG[G/A]
TCAATTTGAATAGACATCACCGATTAATAAAAAAAACCAGAAAAAAGAGGGAAATCAAACAGAGCAAGATCGAGCCAGAGGCCTAGCTATGGAAATACAA

Reverse complement sequence

TTGTATTTCCATAGCTAGGCCTCTGGCTCGATCTTGCTCTGTTTGATTTCCCTCTTTTTTCTGGTTTTTTTTATTAATCGGTGATGTCTATTCAAATTGA[C/T]
CAAAAGAAATACATTGGCCCGTATTAGTCCAACCGTTTTGACATAATCCGGACATAGATATTAGAAAATCTGTTTCACACAACTTGACGAACACTACTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 5.40% 7.91% 27.00% NA
All Indica  2759 63.60% 1.30% 10.29% 24.79% NA
All Japonica  1512 62.70% 8.50% 2.25% 26.59% NA
Aus  269 15.60% 30.10% 15.99% 38.29% NA
Indica I  595 84.50% 0.20% 3.53% 11.76% NA
Indica II  465 67.30% 0.20% 4.95% 27.53% NA
Indica III  913 43.50% 1.40% 18.07% 37.02% NA
Indica Intermediate  786 69.10% 2.50% 9.54% 18.83% NA
Temperate Japonica  767 92.70% 0.30% 0.65% 6.39% NA
Tropical Japonica  504 15.70% 24.20% 3.17% 56.94% NA
Japonica Intermediate  241 65.60% 1.70% 5.39% 27.39% NA
VI/Aromatic  96 20.80% 3.10% 5.21% 70.83% NA
Intermediate  90 58.90% 11.10% 8.89% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215438530 G -> DEL N N silent_mutation Average:23.975; most accessible tissue: Callus, score: 68.271 N N N N
vg1215438530 G -> A LOC_Os12g26410.1 upstream_gene_variant ; 4051.0bp to feature; MODIFIER silent_mutation Average:23.975; most accessible tissue: Callus, score: 68.271 N N N N
vg1215438530 G -> A LOC_Os12g26420.1 downstream_gene_variant ; 1830.0bp to feature; MODIFIER silent_mutation Average:23.975; most accessible tissue: Callus, score: 68.271 N N N N
vg1215438530 G -> A LOC_Os12g26410-LOC_Os12g26420 intergenic_region ; MODIFIER silent_mutation Average:23.975; most accessible tissue: Callus, score: 68.271 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215438530 NA 3.25E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 3.53E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 1.11E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 2.25E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 9.27E-06 mr1398 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 7.39E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 6.45E-06 NA mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 9.51E-06 3.99E-10 mr1551 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 5.92E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 9.85E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 7.21E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 7.26E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 9.49E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 5.39E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 2.64E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215438530 NA 1.43E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251