\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215427937:

Variant ID: vg1215427937 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15427937
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.51, T: 0.49, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAGAGTGTTTAAAGCTGATTTTGAAAATTCTGTTTCACCTGTGATAACATGTTTAGTTGCTAAGTTTGATAAAGATGTGATGTTTTGGCATCGTAGAC[A/T]
TGGACATGTTGGTTTTCATCATCTCACTAGGTTAAGTGGTTTGGATCTTGTTCGTGGTTTGCCTAAACTTAAGAAAGATCTTGATTTGGTTTGTATACCA

Reverse complement sequence

TGGTATACAAACCAAATCAAGATCTTTCTTAAGTTTAGGCAAACCACGAACAAGATCCAAACCACTTAACCTAGTGAGATGATGAAAACCAACATGTCCA[T/A]
GTCTACGATGCCAAAACATCACATCTTTATCAAACTTAGCAACTAAACATGTTATCACAGGTGAAACAGAATTTTCAAAATCAGCTTTAAACACTCTTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.80% 21.80% 2.90% 41.54% NA
All Indica  2759 56.10% 2.90% 3.30% 37.73% NA
All Japonica  1512 1.70% 59.20% 0.46% 38.69% NA
Aus  269 0.70% 6.70% 13.01% 79.55% NA
Indica I  595 80.30% 0.80% 1.01% 17.82% NA
Indica II  465 61.50% 3.90% 0.86% 33.76% NA
Indica III  913 36.50% 1.30% 5.70% 56.52% NA
Indica Intermediate  786 57.40% 5.60% 3.69% 33.33% NA
Temperate Japonica  767 1.00% 91.10% 0.26% 7.56% NA
Tropical Japonica  504 2.40% 9.90% 0.60% 87.10% NA
Japonica Intermediate  241 2.10% 60.60% 0.83% 36.51% NA
VI/Aromatic  96 2.10% 10.40% 1.04% 86.46% NA
Intermediate  90 23.30% 28.90% 3.33% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215427937 A -> DEL LOC_Os12g26400.1 N frameshift_variant Average:14.23; most accessible tissue: Zhenshan97 flag leaf, score: 21.748 N N N N
vg1215427937 A -> T LOC_Os12g26400.1 missense_variant ; p.His874Leu; MODERATE nonsynonymous_codon ; H874L Average:14.23; most accessible tissue: Zhenshan97 flag leaf, score: 21.748 benign -1.051 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215427937 NA 1.14E-29 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 4.22E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 3.92E-06 mr1438 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 2.20E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 1.57E-06 1.53E-07 mr1577 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 1.74E-06 mr1780 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 7.60E-07 mr1792 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 3.63E-06 mr1803 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 4.10E-10 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 1.80E-14 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 8.08E-14 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 6.27E-06 6.27E-06 mr1456_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 1.21E-08 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 4.21E-06 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 1.65E-08 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215427937 NA 2.81E-07 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251