Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215420354:

Variant ID: vg1215420354 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15420354
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAATATTAAAACATGCATAAATTTGAAGCTATGCATCTCATTTCTAATCTAAATATTGTTGTATTTATAATTAAAACAATGATTTAAAGATCCAAAAA[T/G]
CCTATATTTTGAACTAGTATAAAATATAAAATAAAGCAGGTAATAGAAAATGTAATAAGTTCGTAAAAAAATGGGTTCTTACATTACACTATAATTGGAC

Reverse complement sequence

GTCCAATTATAGTGTAATGTAAGAACCCATTTTTTTACGAACTTATTACATTTTCTATTACCTGCTTTATTTTATATTTTATACTAGTTCAAAATATAGG[A/C]
TTTTTGGATCTTTAAATCATTGTTTTAATTATAAATACAACAATATTTAGATTAGAAATGAGATGCATAGCTTCAAATTTATGCATGTTTTAATATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.10%	16.80%	0.11%	0.00%	NA
All Indica	2759	93.20%	6.70%	0.11%	0.00%	NA
All Japonica	1512	71.50%	28.40%	0.07%	0.00%	NA
Aus	269	62.10%	37.50%	0.37%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	73.10%	26.90%	0.00%	0.00%	NA
Indica III	913	98.10%	1.90%	0.00%	0.00%	NA
Indica Intermediate	786	94.30%	5.50%	0.25%	0.00%	NA
Temperate Japonica	767	95.60%	4.40%	0.00%	0.00%	NA
Tropical Japonica	504	32.30%	67.50%	0.20%	0.00%	NA
Japonica Intermediate	241	76.80%	23.20%	0.00%	0.00%	NA
VI/Aromatic	96	39.60%	60.40%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215420354	T -> G	LOC_Os12g26400.1	upstream_gene_variant ; 4780.0bp to feature; MODIFIER	silent_mutation	Average:22.137; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1215420354	T -> G	LOC_Os12g26390.1	downstream_gene_variant ; 1220.0bp to feature; MODIFIER	silent_mutation	Average:22.137; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1215420354	T -> G	LOC_Os12g26380-LOC_Os12g26390	intergenic_region ; MODIFIER	silent_mutation	Average:22.137; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215420354	NA	2.27E-13	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	3.87E-10	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	3.05E-11	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	2.23E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	6.11E-13	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	1.92E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	5.56E-06	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	3.59E-13	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	5.66E-07	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	7.07E-08	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	4.02E-13	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	2.59E-09	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	7.78E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	8.63E-06	mr1633	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	2.07E-07	5.46E-17	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	7.34E-07	4.25E-14	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	1.63E-08	2.20E-18	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	2.17E-09	1.36E-17	mr1079_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	2.68E-08	6.74E-16	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	4.83E-15	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	NA	7.78E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	1.79E-08	6.17E-19	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	8.03E-07	5.74E-11	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215420354	2.23E-09	3.89E-18	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251