Variant ID: vg1215211990 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 15211990 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
ATATGCTCATCTTCGTAATTTATGTCTCACATGGGATGCTCTAGTATGTCTTTTGTATCACAGAAACAATAAATGTTTCATGTTAAATATGTATATATTT[G/A]
TGGTAATTGTATATATTGGTTTTTCTATAAATTAGTGCTCAGGGATCGGCCTGTGTTTGGTACACTAAATTTGAAGTAAAATTTTCTGGGAACTTAATAT
ATATTAAGTTCCCAGAAAATTTTACTTCAAATTTAGTGTACCAAACACAGGCCGATCCCTGAGCACTAATTTATAGAAAAACCAATATATACAATTACCA[C/T]
AAATATATACATATTTAACATGAAACATTTATTGTTTCTGTGATACAAAAGACATACTAGAGCATCCCATGTGAGACATAAATTACGAAGATGAGCATAT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.20% | 3.90% | 0.95% | 0.00% | NA |
All Indica | 2759 | 99.50% | 0.30% | 0.22% | 0.00% | NA |
All Japonica | 1512 | 87.10% | 10.40% | 2.45% | 0.00% | NA |
Aus | 269 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.60% | 0.60% | 0.76% | 0.00% | NA |
Temperate Japonica | 767 | 94.90% | 1.70% | 3.39% | 0.00% | NA |
Tropical Japonica | 504 | 78.80% | 21.00% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 79.70% | 16.20% | 4.15% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 94.40% | 3.30% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1215211990 | G -> A | LOC_Os12g26120-LOC_Os12g26140 | intergenic_region ; MODIFIER | silent_mutation | Average:37.745; most accessible tissue: Zhenshan97 young leaf, score: 63.653 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1215211990 | 3.73E-06 | NA | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1215211990 | 1.86E-06 | NA | mr1017 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1215211990 | 3.57E-06 | NA | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1215211990 | 7.26E-07 | NA | mr1022_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1215211990 | 3.74E-06 | NA | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1215211990 | 3.71E-07 | NA | mr1079_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |