Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1215204129:

Variant ID: vg1215204129 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15204129
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, G: 0.47, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AAACGCCACATGTCACTTTAATAAACAACTGGACCCACTATTTTGTTAGAACTATTTCCGAAACAAAATAATATGCATGCCTACGCGAATGCGTGAGCTA[C/G,T]
CTTCCTAGTTAGTTTAATAGATCTAATGTAATAGTTAAAATTATTGAGTCCACCAGTTTTAGTATAAATCAATCGCTAGATGTTTTACTTTTTTAGAATT

Reverse complement sequence

AATTCTAAAAAAGTAAAACATCTAGCGATTGATTTATACTAAAACTGGTGGACTCAATAATTTTAACTATTACATTAGATCTATTAAACTAACTAGGAAG[G/C,A]
TAGCTCACGCATTCGCGTAGGCATGCATATTATTTTGTTTCGGAAATAGTTCTAACAAAATAGTGGGTCCAGTTGTTTATTAAAGTGACATGTGGCGTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.60%	19.70%	0.74%	0.00%	NA
All Indica	2759	72.70%	27.00%	0.22%	0.00%	NA
All Japonica	1512	87.30%	11.00%	1.65%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	92.10%	7.60%	0.34%	0.00%	NA
Indica II	465	44.90%	54.80%	0.22%	0.00%	NA
Indica III	913	76.30%	23.40%	0.22%	0.00%	NA
Indica Intermediate	786	70.40%	29.50%	0.13%	0.00%	NA
Temperate Japonica	767	93.90%	5.90%	0.26%	0.00%	NA
Tropical Japonica	504	79.00%	17.10%	3.97%	0.00%	NA
Japonica Intermediate	241	83.80%	14.90%	1.24%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	14.40%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215204129	C -> G	LOC_Os12g26120.1	downstream_gene_variant ; 2685.0bp to feature; MODIFIER	silent_mutation	Average:33.564; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg1215204129	C -> G	LOC_Os12g26120-LOC_Os12g26140	intergenic_region ; MODIFIER	silent_mutation	Average:33.564; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg1215204129	C -> T	LOC_Os12g26120.1	downstream_gene_variant ; 2685.0bp to feature; MODIFIER	N	Average:33.564; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg1215204129	C -> T	LOC_Os12g26120-LOC_Os12g26140	intergenic_region ; MODIFIER	N	Average:33.564; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215204129	NA	5.12E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215204129	NA	2.57E-07	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215204129	8.13E-06	8.13E-06	mr1325	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215204129	2.08E-06	2.08E-06	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215204129	NA	1.45E-08	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215204129	NA	1.44E-08	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215204129	6.87E-06	6.87E-06	mr1333_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215204129	5.38E-06	7.44E-07	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215204129	NA	9.35E-07	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215204129	NA	5.39E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215204129	2.18E-06	2.18E-06	mr1960_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251