Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215163870:

Variant ID: vg1215163870 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15163870
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

ATATATATATATATATATATATATATATATATATATGTATTTAAACATATATATATGCATAGTATATCAGTACAGTCAGCAAGCAACACAACAAAATAAT[A/T]
AAAAAGAAAAAATGTCTTTAGTCCCGAGACTAAAGATGGCTGAGCCACATACTATCTTTAGTTCTAGATTCTCCCTTCCGGTTTATAACCCGGGACTAAA

Reverse complement sequence

TTTAGTCCCGGGTTATAAACCGGAAGGGAGAATCTAGAACTAAAGATAGTATGTGGCTCAGCCATCTTTAGTCTCGGGACTAAAGACATTTTTTCTTTTT[T/A]
ATTATTTTGTTGTGTTGCTTGCTGACTGTACTGATATACTATGCATATATATATGTTTAAATACATATATATATATATATATATATATATATATATATAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.40%	24.10%	0.61%	38.85%	NA
All Indica	2759	22.50%	32.90%	0.87%	43.71%	NA
All Japonica	1512	68.80%	13.40%	0.07%	17.72%	NA
Aus	269	6.30%	1.90%	0.37%	91.45%	NA
Indica I	595	13.90%	23.00%	1.18%	61.85%	NA
Indica II	465	25.80%	55.70%	0.86%	17.63%	NA
Indica III	913	26.40%	25.40%	0.00%	48.19%	NA
Indica Intermediate	786	22.50%	35.60%	1.65%	40.20%	NA
Temperate Japonica	767	88.90%	6.50%	0.00%	4.56%	NA
Tropical Japonica	504	42.10%	22.20%	0.20%	35.52%	NA
Japonica Intermediate	241	60.60%	17.00%	0.00%	22.41%	NA
VI/Aromatic	96	2.10%	2.10%	2.08%	93.75%	NA
Intermediate	90	45.60%	24.40%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215163870	A -> DEL	N	N	silent_mutation	Average:14.002; most accessible tissue: Callus, score: 47.919	N	N	N	N
vg1215163870	A -> T	LOC_Os12g26080-LOC_Os12g26090	intergenic_region ; MODIFIER	silent_mutation	Average:14.002; most accessible tissue: Callus, score: 47.919	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215163870	NA	7.64E-06	mr1136	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	NA	1.76E-07	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	NA	3.24E-07	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	NA	1.49E-06	mr1298	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	NA	3.96E-07	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	9.61E-06	9.61E-06	mr1544	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	8.56E-06	6.76E-08	mr1579	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	NA	3.62E-06	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	NA	1.58E-08	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	NA	5.38E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	NA	1.08E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	NA	9.76E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215163870	NA	3.49E-06	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251