\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214948506:

Variant ID: vg1214948506 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14948506
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGTAGCTCCCTTATATACACATTTATCTACACACTATCAAACTATATTGCTTAGGTCCGGTTTGGTAATAATACTTTAGATATCTTTTAGTTTCTTTC[T/C]
ATGGATTATATGGATGGATAGCGTTACGGGAATGATGTTATTATTAATTTAATTTATAATTGCCTATCGTGAATGTCCGTATTTACAGGGGAGACTCTAT

Reverse complement sequence

ATAGAGTCTCCCCTGTAAATACGGACATTCACGATAGGCAATTATAAATTAAATTAATAATAACATCATTCCCGTAACGCTATCCATCCATATAATCCAT[A/G]
GAAAGAAACTAAAAGATATCTAAAGTATTATTACCAAACCGGACCTAAGCAATATAGTTTGATAGTGTGTAGATAAATGTGTATATAAGGGAGCTACTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 26.10% 0.47% 16.69% NA
All Indica  2759 38.10% 33.10% 0.69% 28.05% NA
All Japonica  1512 84.90% 14.90% 0.00% 0.26% NA
Aus  269 80.70% 18.60% 0.37% 0.37% NA
Indica I  595 11.60% 68.40% 0.67% 19.33% NA
Indica II  465 51.40% 17.80% 0.65% 30.11% NA
Indica III  913 43.30% 20.00% 0.77% 35.93% NA
Indica Intermediate  786 44.40% 30.70% 0.64% 24.30% NA
Temperate Japonica  767 96.20% 3.40% 0.00% 0.39% NA
Tropical Japonica  504 68.70% 31.30% 0.00% 0.00% NA
Japonica Intermediate  241 82.60% 17.00% 0.00% 0.41% NA
VI/Aromatic  96 68.80% 22.90% 1.04% 7.29% NA
Intermediate  90 72.20% 23.30% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214948506 T -> C LOC_Os12g25770.1 upstream_gene_variant ; 3041.0bp to feature; MODIFIER silent_mutation Average:31.573; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg1214948506 T -> C LOC_Os12g25770-LOC_Os12g25790 intergenic_region ; MODIFIER silent_mutation Average:31.573; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg1214948506 T -> DEL N N silent_mutation Average:31.573; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214948506 NA 1.18E-06 mr1186 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 1.98E-06 mr1616 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 9.51E-06 9.51E-06 mr1877 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 4.28E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 9.80E-08 2.72E-09 mr1898 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 1.43E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 5.04E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 1.13E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 6.86E-10 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 4.33E-06 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 1.04E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 6.72E-06 NA mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 2.87E-06 1.72E-08 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 9.57E-06 mr1316_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 1.05E-07 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 4.57E-07 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 1.05E-09 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 3.05E-06 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214948506 NA 5.25E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251