Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214940906:

Variant ID: vg1214940906 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14940906
Reference Allele: C	Alternative Allele: T,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAACAAAAAGGGGAGGCGTCCAGGAAAATCAATCATATAGTAGTGTAGGTACACATATATGTTTAGATTCATTAGCATCTATATGAATGTGGACAATG[C/T,A]
TAGAAAGTCTTACGTTATGAAACGGAGGAAGTACTACAAAGTATCTCTATCTTGTATAGCCAGTTAGCCACCCACGCTCTGCTTCTGTCTCGGCCACCTT

Reverse complement sequence

AAGGTGGCCGAGACAGAAGCAGAGCGTGGGTGGCTAACTGGCTATACAAGATAGAGATACTTTGTAGTACTTCCTCCGTTTCATAACGTAAGACTTTCTA[G/A,T]
CATTGTCCACATTCATATAGATGCTAATGAATCTAAACATATATGTGTACCTACACTACTATATGATTGATTTTCCTGGACGCCTCCCCTTTTTGTTTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.90%	45.80%	0.15%	0.00%	A: 0.13%
All Indica	2759	70.00%	29.60%	0.18%	0.00%	A: 0.22%
All Japonica	1512	32.50%	67.50%	0.00%	0.00%	NA
Aus	269	20.80%	79.20%	0.00%	0.00%	NA
Indica I	595	48.40%	51.40%	0.17%	0.00%	NA
Indica II	465	87.10%	11.60%	0.22%	0.00%	A: 1.08%
Indica III	913	78.60%	21.20%	0.00%	0.00%	A: 0.11%
Indica Intermediate	786	66.30%	33.30%	0.38%	0.00%	NA
Temperate Japonica	767	12.40%	87.60%	0.00%	0.00%	NA
Tropical Japonica	504	59.30%	40.70%	0.00%	0.00%	NA
Japonica Intermediate	241	40.20%	59.80%	0.00%	0.00%	NA
VI/Aromatic	96	30.20%	69.80%	0.00%	0.00%	NA
Intermediate	90	44.40%	53.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214940906	C -> A	LOC_Os12g25770.1	downstream_gene_variant ; 4284.0bp to feature; MODIFIER	silent_mutation	Average:67.107; most accessible tissue: Zhenshan97 young leaf, score: 84.035	N	N	N	N
vg1214940906	C -> A	LOC_Os12g25760-LOC_Os12g25770	intergenic_region ; MODIFIER	silent_mutation	Average:67.107; most accessible tissue: Zhenshan97 young leaf, score: 84.035	N	N	N	N
vg1214940906	C -> T	LOC_Os12g25770.1	downstream_gene_variant ; 4284.0bp to feature; MODIFIER	silent_mutation	Average:67.107; most accessible tissue: Zhenshan97 young leaf, score: 84.035	N	N	N	N
vg1214940906	C -> T	LOC_Os12g25760-LOC_Os12g25770	intergenic_region ; MODIFIER	silent_mutation	Average:67.107; most accessible tissue: Zhenshan97 young leaf, score: 84.035	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214940906	NA	3.36E-10	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	6.62E-11	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.25E-10	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	5.54E-11	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	4.95E-06	1.16E-09	mr1186	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.47E-10	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	5.61E-07	mr1616	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.99E-08	mr1639	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.59E-13	mr1778	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.28E-11	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	2.43E-20	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.06E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.25E-15	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	4.99E-06	mr1164_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	3.54E-06	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	4.11E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.36E-07	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	9.77E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	5.52E-06	5.52E-06	mr1345_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	3.81E-06	mr1361_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	2.16E-06	mr1415_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.15E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	6.94E-06	6.94E-06	mr1424_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.31E-17	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	9.50E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	9.48E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	5.04E-07	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.67E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	8.11E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	2.33E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	3.66E-08	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.23E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.72E-06	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	5.07E-15	mr1778_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.09E-07	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	3.22E-06	mr1849_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	9.41E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	3.38E-07	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	1.92E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	5.13E-08	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	9.22E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	4.20E-10	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214940906	NA	2.30E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251