\
| Variant ID: vg1214822906 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14822906 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 101. )
AGGCAGCGGCTCGGTTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCACAATCTCCACTCCGCGTAACCGAACCGGATAAGTCGTGCGTAACTGAT[C/T]
CGGACTCCACGCCGTTTTCACGCACCGGATTTTTCGGAATGTTTCCAACAACGAAACAAATCCAAATTTTCCTGCAGCAAAACAAAACTGCAAAAGAAGG
CCTTCTTTTGCAGTTTTGTTTTGCTGCAGGAAAATTTGGATTTGTTTCGTTGTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAACGGCGTGGAGTCCG[G/A]
ATCAGTTACGCACGACTTATCCGGTTCGGTTACGCGGAGTGGAGATTGTGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAACCGAGCCGCTGCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 25.60% | 2.98% | 6.83% | NA |
| All Indica | 2759 | 47.80% | 35.90% | 4.89% | 11.42% | NA |
| All Japonica | 1512 | 86.80% | 13.00% | 0.20% | 0.07% | NA |
| Aus | 269 | 97.80% | 1.50% | 0.37% | 0.37% | NA |
| Indica I | 595 | 67.60% | 21.80% | 8.91% | 1.68% | NA |
| Indica II | 465 | 24.10% | 71.80% | 0.65% | 3.44% | NA |
| Indica III | 913 | 47.50% | 26.10% | 4.16% | 22.23% | NA |
| Indica Intermediate | 786 | 47.10% | 36.80% | 5.22% | 10.94% | NA |
| Temperate Japonica | 767 | 93.60% | 6.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 78.40% | 21.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 82.60% | 16.60% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 20.00% | 2.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214822906 | C -> DEL | N | N | silent_mutation | Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 | N | N | N | N |
| vg1214822906 | C -> T | LOC_Os12g25600.1 | upstream_gene_variant ; 3109.0bp to feature; MODIFIER | silent_mutation | Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 | N | N | N | N |
| vg1214822906 | C -> T | LOC_Os12g25630.1 | downstream_gene_variant ; 4406.0bp to feature; MODIFIER | silent_mutation | Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 | N | N | N | N |
| vg1214822906 | C -> T | LOC_Os12g25610.1 | intron_variant ; MODIFIER | silent_mutation | Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214822906 | NA | 1.76E-07 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214822906 | NA | 5.66E-07 | mr1280 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214822906 | NA | 5.12E-07 | mr1298 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214822906 | NA | 7.58E-06 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214822906 | NA | 3.27E-06 | mr1579 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214822906 | 2.32E-06 | 1.39E-09 | mr1889 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214822906 | NA | 1.58E-08 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214822906 | 6.08E-06 | 6.08E-06 | mr1487_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214822906 | NA | 5.38E-06 | mr1633_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214822906 | NA | 1.08E-06 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214822906 | NA | 9.76E-06 | mr1830_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214822906 | NA | 8.43E-07 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |