\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214822906:

Variant ID: vg1214822906 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14822906
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCAGCGGCTCGGTTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCACAATCTCCACTCCGCGTAACCGAACCGGATAAGTCGTGCGTAACTGAT[C/T]
CGGACTCCACGCCGTTTTCACGCACCGGATTTTTCGGAATGTTTCCAACAACGAAACAAATCCAAATTTTCCTGCAGCAAAACAAAACTGCAAAAGAAGG

Reverse complement sequence

CCTTCTTTTGCAGTTTTGTTTTGCTGCAGGAAAATTTGGATTTGTTTCGTTGTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAACGGCGTGGAGTCCG[G/A]
ATCAGTTACGCACGACTTATCCGGTTCGGTTACGCGGAGTGGAGATTGTGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAACCGAGCCGCTGCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 25.60% 2.98% 6.83% NA
All Indica  2759 47.80% 35.90% 4.89% 11.42% NA
All Japonica  1512 86.80% 13.00% 0.20% 0.07% NA
Aus  269 97.80% 1.50% 0.37% 0.37% NA
Indica I  595 67.60% 21.80% 8.91% 1.68% NA
Indica II  465 24.10% 71.80% 0.65% 3.44% NA
Indica III  913 47.50% 26.10% 4.16% 22.23% NA
Indica Intermediate  786 47.10% 36.80% 5.22% 10.94% NA
Temperate Japonica  767 93.60% 6.30% 0.13% 0.00% NA
Tropical Japonica  504 78.40% 21.40% 0.00% 0.20% NA
Japonica Intermediate  241 82.60% 16.60% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 20.00% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214822906 C -> DEL N N silent_mutation Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg1214822906 C -> T LOC_Os12g25600.1 upstream_gene_variant ; 3109.0bp to feature; MODIFIER silent_mutation Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg1214822906 C -> T LOC_Os12g25630.1 downstream_gene_variant ; 4406.0bp to feature; MODIFIER silent_mutation Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg1214822906 C -> T LOC_Os12g25610.1 intron_variant ; MODIFIER silent_mutation Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214822906 NA 1.76E-07 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906 NA 5.66E-07 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906 NA 5.12E-07 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906 NA 7.58E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906 NA 3.27E-06 mr1579 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906 2.32E-06 1.39E-09 mr1889 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906 NA 1.58E-08 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906 6.08E-06 6.08E-06 mr1487_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906 NA 5.38E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906 NA 1.08E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906 NA 9.76E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906 NA 8.43E-07 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251