Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214822893:

Variant ID: vg1214822893 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14822893
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTGTTGCGTGAAGGCAGCGGCTCGGTTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCACAATCTCCACTCCGCGTAACCGAACCGGATAAGTC[G/A]
TGCGTAACTGATCCGGACTCCACGCCGTTTTCACGCACCGGATTTTTCGGAATGTTTCCAACAACGAAACAAATCCAAATTTTCCTGCAGCAAAACAAAA

Reverse complement sequence

TTTTGTTTTGCTGCAGGAAAATTTGGATTTGTTTCGTTGTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAACGGCGTGGAGTCCGGATCAGTTACGCA[C/T]
GACTTATCCGGTTCGGTTACGCGGAGTGGAGATTGTGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAACCGAGCCGCTGCCTTCACGCAACACAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	25.70%	3.05%	6.28%	NA
All Indica	2759	48.40%	36.10%	5.00%	10.47%	NA
All Japonica	1512	87.00%	12.80%	0.20%	0.07%	NA
Aus	269	97.80%	1.50%	0.37%	0.37%	NA
Indica I	595	67.70%	22.40%	8.57%	1.34%	NA
Indica II	465	24.10%	71.80%	0.65%	3.44%	NA
Indica III	913	48.80%	26.10%	4.93%	20.15%	NA
Indica Intermediate	786	47.70%	37.00%	4.96%	10.31%	NA
Temperate Japonica	767	93.70%	6.10%	0.13%	0.00%	NA
Tropical Japonica	504	78.60%	21.20%	0.00%	0.20%	NA
Japonica Intermediate	241	83.00%	16.20%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	70.00%	21.10%	2.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214822893	G -> DEL	N	N	silent_mutation	Average:64.561; most accessible tissue: Zhenshan97 flag leaf, score: 81.605	N	N	N	N
vg1214822893	G -> A	LOC_Os12g25600.1	upstream_gene_variant ; 3096.0bp to feature; MODIFIER	silent_mutation	Average:64.561; most accessible tissue: Zhenshan97 flag leaf, score: 81.605	N	N	N	N
vg1214822893	G -> A	LOC_Os12g25630.1	downstream_gene_variant ; 4419.0bp to feature; MODIFIER	silent_mutation	Average:64.561; most accessible tissue: Zhenshan97 flag leaf, score: 81.605	N	N	N	N
vg1214822893	G -> A	LOC_Os12g25610.1	intron_variant ; MODIFIER	silent_mutation	Average:64.561; most accessible tissue: Zhenshan97 flag leaf, score: 81.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214822893	NA	1.76E-07	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	3.22E-07	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	1.39E-06	mr1298	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	3.51E-06	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	9.17E-07	mr1579	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	8.39E-06	mr1788	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	1.28E-09	mr1889	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	1.58E-08	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	6.11E-06	mr1227_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	5.37E-06	mr1318_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	2.77E-06	2.77E-06	mr1487_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	7.92E-06	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	4.46E-06	mr1603_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	5.38E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	1.08E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	4.09E-06	mr1780_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	9.76E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893	NA	1.34E-07	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251