\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214822893:

Variant ID: vg1214822893 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14822893
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTGTTGCGTGAAGGCAGCGGCTCGGTTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCACAATCTCCACTCCGCGTAACCGAACCGGATAAGTC[G/A]
TGCGTAACTGATCCGGACTCCACGCCGTTTTCACGCACCGGATTTTTCGGAATGTTTCCAACAACGAAACAAATCCAAATTTTCCTGCAGCAAAACAAAA

Reverse complement sequence

TTTTGTTTTGCTGCAGGAAAATTTGGATTTGTTTCGTTGTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAACGGCGTGGAGTCCGGATCAGTTACGCA[C/T]
GACTTATCCGGTTCGGTTACGCGGAGTGGAGATTGTGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAACCGAGCCGCTGCCTTCACGCAACACAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 25.70% 3.05% 6.28% NA
All Indica  2759 48.40% 36.10% 5.00% 10.47% NA
All Japonica  1512 87.00% 12.80% 0.20% 0.07% NA
Aus  269 97.80% 1.50% 0.37% 0.37% NA
Indica I  595 67.70% 22.40% 8.57% 1.34% NA
Indica II  465 24.10% 71.80% 0.65% 3.44% NA
Indica III  913 48.80% 26.10% 4.93% 20.15% NA
Indica Intermediate  786 47.70% 37.00% 4.96% 10.31% NA
Temperate Japonica  767 93.70% 6.10% 0.13% 0.00% NA
Tropical Japonica  504 78.60% 21.20% 0.00% 0.20% NA
Japonica Intermediate  241 83.00% 16.20% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 70.00% 21.10% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214822893 G -> DEL N N silent_mutation Average:64.561; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg1214822893 G -> A LOC_Os12g25600.1 upstream_gene_variant ; 3096.0bp to feature; MODIFIER silent_mutation Average:64.561; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg1214822893 G -> A LOC_Os12g25630.1 downstream_gene_variant ; 4419.0bp to feature; MODIFIER silent_mutation Average:64.561; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg1214822893 G -> A LOC_Os12g25610.1 intron_variant ; MODIFIER silent_mutation Average:64.561; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214822893 NA 1.76E-07 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 3.22E-07 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 1.39E-06 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 3.51E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 9.17E-07 mr1579 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 8.39E-06 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 1.28E-09 mr1889 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 1.58E-08 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 6.11E-06 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 5.37E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 2.77E-06 2.77E-06 mr1487_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 7.92E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 4.46E-06 mr1603_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 5.38E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 1.08E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 4.09E-06 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 9.76E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822893 NA 1.34E-07 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251