\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214799785:

Variant ID: vg1214799785 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14799785
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTAATCGGCTAAGATACTTTAGTACTTTACTGTCTCAACAATCCTTCGTGCCGATTAATACAACATATAACTTTGCTAAAAAATTTTCATTTTCATTTT[G/T]
TGTACATATGTGCCCCCTTAATTTTACAATGTCAAAAGCATTGATAAAATTATAAAAACAACTAAGGGCGATATAATAATATCAGCCATTGTATATCGGC

Reverse complement sequence

GCCGATATACAATGGCTGATATTATTATATCGCCCTTAGTTGTTTTTATAATTTTATCAATGCTTTTGACATTGTAAAATTAAGGGGGCACATATGTACA[C/A]
AAAATGAAAATGAAAATTTTTTAGCAAAGTTATATGTTGTATTAATCGGCACGAAGGATTGTTGAGACAGTAAAGTACTAAAGTATCTTAGCCGATTACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.60% 0.60% 46.42% 11.36% NA
All Indica  2759 30.30% 0.80% 65.28% 3.66% NA
All Japonica  1512 69.00% 0.10% 3.44% 27.45% NA
Aus  269 15.20% 1.50% 81.41% 1.86% NA
Indica I  595 21.00% 0.70% 76.64% 1.68% NA
Indica II  465 25.80% 0.20% 65.38% 8.60% NA
Indica III  913 38.10% 1.00% 58.60% 2.30% NA
Indica Intermediate  786 30.90% 0.90% 64.38% 3.82% NA
Temperate Japonica  767 89.70% 0.00% 2.22% 8.08% NA
Tropical Japonica  504 42.10% 0.20% 3.57% 54.17% NA
Japonica Intermediate  241 59.80% 0.00% 7.05% 33.20% NA
VI/Aromatic  96 5.20% 4.20% 84.38% 6.25% NA
Intermediate  90 43.30% 0.00% 45.56% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214799785 G -> DEL N N silent_mutation Average:18.921; most accessible tissue: Callus, score: 41.987 N N N N
vg1214799785 G -> T LOC_Os12g25570.1 downstream_gene_variant ; 130.0bp to feature; MODIFIER silent_mutation Average:18.921; most accessible tissue: Callus, score: 41.987 N N N N
vg1214799785 G -> T LOC_Os12g25580.1 downstream_gene_variant ; 223.0bp to feature; MODIFIER silent_mutation Average:18.921; most accessible tissue: Callus, score: 41.987 N N N N
vg1214799785 G -> T LOC_Os12g25570-LOC_Os12g25580 intergenic_region ; MODIFIER silent_mutation Average:18.921; most accessible tissue: Callus, score: 41.987 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214799785 NA 8.34E-29 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 7.20E-06 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 3.41E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 5.56E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 9.27E-07 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 9.89E-06 NA mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 4.32E-06 mr1139 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 5.47E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 3.27E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 9.63E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 2.61E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 4.66E-06 mr1397 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 1.23E-06 NA mr1437 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 1.06E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 2.38E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 4.04E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 2.19E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 1.95E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214799785 NA 8.64E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251