\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214693299:

Variant ID: vg1214693299 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14693299
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.19, T: 0.05, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


GCTCTGAATTGATCTAGGGGGTAATTCATCCGGTTTACAAAGTTTAGGGTCAAAAATAACTGGTATTGAAGTTTAGGGTGGTAAATCGGACGACGCAATT[A/G]
TTTAGGGGGTAATTCGTAATTTTTCCTTTTATTTATATATATGTATAGAGAGACTTCTACCATGGGAACCGTGGATATTCTAGTGCTCAAAAAATTCTAT

Reverse complement sequence

ATAGAATTTTTTGAGCACTAGAATATCCACGGTTCCCATGGTAGAAGTCTCTCTATACATATATATAAATAAAAGGAAAAATTACGAATTACCCCCTAAA[T/C]
AATTGCGTCGTCCGATTTACCACCCTAAACTTCAATACCAGTTATTTTTGACCCTAAACTTTGTAAACCGGATGAATTACCCCCTAGATCAATTCAGAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 27.40% 0.63% 7.36% NA
All Indica  2759 66.70% 20.20% 0.91% 12.29% NA
All Japonica  1512 75.20% 24.50% 0.20% 0.07% NA
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 33.30% 46.60% 0.50% 19.66% NA
Indica II  465 82.60% 15.90% 0.22% 1.29% NA
Indica III  913 80.70% 6.10% 1.20% 11.94% NA
Indica Intermediate  786 66.20% 19.00% 1.27% 13.61% NA
Temperate Japonica  767 94.10% 5.70% 0.00% 0.13% NA
Tropical Japonica  504 47.60% 52.00% 0.40% 0.00% NA
Japonica Intermediate  241 72.60% 27.00% 0.41% 0.00% NA
VI/Aromatic  96 10.40% 87.50% 0.00% 2.08% NA
Intermediate  90 61.10% 30.00% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214693299 A -> DEL N N silent_mutation Average:49.457; most accessible tissue: Callus, score: 92.847 N N N N
vg1214693299 A -> G LOC_Os12g25409-LOC_Os12g25420 intergenic_region ; MODIFIER silent_mutation Average:49.457; most accessible tissue: Callus, score: 92.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214693299 NA 5.46E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 3.30E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 9.54E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 6.23E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 6.06E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 7.36E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 1.55E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 5.59E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 1.55E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 2.82E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 1.84E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 8.83E-09 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 1.44E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 6.54E-08 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 2.03E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 4.64E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 2.48E-10 mr1170_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 4.37E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 6.09E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 9.64E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 1.06E-06 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 9.57E-07 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 1.13E-06 1.13E-06 mr1356_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 8.18E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 1.24E-06 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 5.70E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 2.35E-06 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 7.09E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 9.12E-07 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 9.46E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 8.02E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 6.67E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214693299 NA 1.97E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251