Search for Variation information by Variation ID:
Detailed information for vg1214592827:
| Variant ID: vg1214592827 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14592827 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )
Flanking Sequence (100 bp) in Reference Genome:
TATCCCTGGAATGTCGCGATCGACCCAGACGGTCCCCTCGCCAGGAAGGCAAGTTGTTGGTTGATCGTCTCGTTACCCATGAGATGTTGTCGTAGCCACG[C/T]
GGGGAAAGTATCAATGTGATGCCGTGCAATCCATGCATCGGACTTACCGATGTTTCTGGCGTGAACTAAAGCCAAGTGCTCCTCGATGTAAGGAGCTACC
Reverse complement sequence
GGTAGCTCCTTACATCGAGGAGCACTTGGCTTTAGTTCACGCCAGAAACATCGGTAAGTCCGATGCATGGATTGCACGGCATCACATTGATACTTTCCCC[G/A]
CGTGGCTACGACAACATCTCATGGGTAACGAGACGATCAACCAACAACTTGCCTTCCTGGCGAGGGGACCGTCTGGGTCGATCGCGACATTCCAGGGATA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 8.80% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 85.20% | 14.70% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 78.80% | 20.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.50% | 16.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 84.60% | 15.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214592827 | C -> T | LOC_Os12g25320.1 | missense_variant ; p.Ala582Thr; MODERATE | nonsynonymous_codon ; A582M | Average:22.651; most accessible tissue: Zhenshan97 panicle, score: 39.652 | probably damaging  |
2.855 |
DELETERIOUS | 0.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214592827 | NA | 8.32E-06 | mr1322 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214592827 | 1.04E-06 | 1.04E-06 | mr1323 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214592827 | NA | 2.93E-06 | mr1438 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214592827 | 1.81E-06 | 1.81E-06 | mr1540 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214592827 | 1.90E-06 | 1.90E-06 | mr1568 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214592827 | 3.42E-06 | 5.66E-07 | mr1630 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214592827 | 6.65E-06 | 2.52E-06 | mr1732 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |