| Variant ID: vg1214334991 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14334991 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGGCCAAGACTTAAATGTTTTTCCAATGGCTTAGATTAGGGTTGGCTAATTTAAAGGGGATTCTGTTGGTTTCGGCAACGATGAATTCAGTAGGGTCAA[G/T]
ATCACCAATCGGTCCAAGAAAATAGTGATTCTCATGCGACAGGCTCAGAATTGCGACTAGATTGGAAAGATGCTACGAATCCAGAGAGAATAGAGAAGAA
TTCTTCTCTATTCTCTCTGGATTCGTAGCATCTTTCCAATCTAGTCGCAATTCTGAGCCTGTCGCATGAGAATCACTATTTTCTTGGACCGATTGGTGAT[C/A]
TTGACCCTACTGAATTCATCGTTGCCGAAACCAACAGAATCCCCTTTAAATTAGCCAACCCTAATCTAAGCCATTGGAAAAACATTTAAGTCTTGGCCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.70% | 11.80% | 0.06% | 51.50% | NA |
| All Indica | 2759 | 16.40% | 8.40% | 0.11% | 75.14% | NA |
| All Japonica | 1512 | 76.90% | 19.60% | 0.00% | 3.44% | NA |
| Aus | 269 | 21.90% | 2.60% | 0.00% | 75.46% | NA |
| Indica I | 595 | 28.20% | 6.70% | 0.17% | 64.87% | NA |
| Indica II | 465 | 24.90% | 3.00% | 0.00% | 72.04% | NA |
| Indica III | 913 | 5.70% | 10.70% | 0.11% | 83.46% | NA |
| Indica Intermediate | 786 | 14.80% | 10.10% | 0.13% | 75.06% | NA |
| Temperate Japonica | 767 | 88.90% | 5.90% | 0.00% | 5.22% | NA |
| Tropical Japonica | 504 | 67.30% | 31.90% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 58.90% | 37.80% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 18.80% | 0.00% | 0.00% | 81.25% | NA |
| Intermediate | 90 | 45.60% | 23.30% | 0.00% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214334991 | G -> DEL | N | N | silent_mutation | Average:40.261; most accessible tissue: Zhenshan97 young leaf, score: 69.723 | N | N | N | N |
| vg1214334991 | G -> T | LOC_Os12g24960.1 | upstream_gene_variant ; 4132.0bp to feature; MODIFIER | silent_mutation | Average:40.261; most accessible tissue: Zhenshan97 young leaf, score: 69.723 | N | N | N | N |
| vg1214334991 | G -> T | LOC_Os12g24980.1 | downstream_gene_variant ; 1783.0bp to feature; MODIFIER | silent_mutation | Average:40.261; most accessible tissue: Zhenshan97 young leaf, score: 69.723 | N | N | N | N |
| vg1214334991 | G -> T | LOC_Os12g24970.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.261; most accessible tissue: Zhenshan97 young leaf, score: 69.723 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214334991 | NA | 5.51E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214334991 | NA | 3.54E-08 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214334991 | NA | 8.95E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214334991 | 3.32E-06 | 8.25E-10 | mr1696_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214334991 | NA | 1.92E-09 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214334991 | NA | 7.84E-06 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |