\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214147827:

Variant ID: vg1214147827 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14147827
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.21, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CCATGTCAAAGGTGATCGAGGAGTCAATCACAAGTTATATAATCTATCAATATGTTCGAGTGAATGATTGAGCTATTAGAGGATGGCACATATCTAGCCT[C/T]
GAGCTTAATCGATATCGTGAGGCAAAGGGGTTCATACAAGTATACACTAGAGGTTCAGCCGATATGATCTTTATGTATGCCTGGTGGGTCAATATGTTCT

Reverse complement sequence

AGAACATATTGACCCACCAGGCATACATAAAGATCATATCGGCTGAACCTCTAGTGTATACTTGTATGAACCCCTTTGCCTCACGATATCGATTAAGCTC[G/A]
AGGCTAGATATGTGCCATCCTCTAATAGCTCAATCATTCACTCGAACATATTGATAGATTATATAACTTGTGATTGACTCCTCGATCACCTTTGACATGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.40% 23.80% 35.00% 5.76% NA
All Indica  2759 47.50% 8.10% 40.81% 3.62% NA
All Japonica  1512 20.40% 47.00% 21.56% 10.98% NA
Aus  269 7.80% 48.70% 42.75% 0.74% NA
Indica I  595 48.40% 2.40% 45.71% 3.53% NA
Indica II  465 59.40% 11.00% 27.96% 1.72% NA
Indica III  913 43.40% 9.20% 43.59% 3.83% NA
Indica Intermediate  786 44.50% 9.40% 41.48% 4.58% NA
Temperate Japonica  767 10.30% 76.30% 9.78% 3.65% NA
Tropical Japonica  504 36.30% 12.50% 35.91% 15.28% NA
Japonica Intermediate  241 19.50% 26.10% 29.05% 25.31% NA
VI/Aromatic  96 12.50% 26.00% 61.46% 0.00% NA
Intermediate  90 25.60% 38.90% 31.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214147827 C -> DEL N N silent_mutation Average:16.177; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 N N N N
vg1214147827 C -> T LOC_Os12g24690.1 upstream_gene_variant ; 1631.0bp to feature; MODIFIER silent_mutation Average:16.177; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 N N N N
vg1214147827 C -> T LOC_Os12g24680-LOC_Os12g24690 intergenic_region ; MODIFIER silent_mutation Average:16.177; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214147827 4.42E-07 NA mr1022 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827 NA 1.32E-14 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827 NA 4.52E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827 NA 1.52E-16 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827 NA 8.46E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827 NA 2.39E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827 NA 1.93E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827 NA 1.73E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827 NA 2.82E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251