Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1214147827:

Variant ID: vg1214147827 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14147827
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.21, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

CCATGTCAAAGGTGATCGAGGAGTCAATCACAAGTTATATAATCTATCAATATGTTCGAGTGAATGATTGAGCTATTAGAGGATGGCACATATCTAGCCT[C/T]
GAGCTTAATCGATATCGTGAGGCAAAGGGGTTCATACAAGTATACACTAGAGGTTCAGCCGATATGATCTTTATGTATGCCTGGTGGGTCAATATGTTCT

Reverse complement sequence

AGAACATATTGACCCACCAGGCATACATAAAGATCATATCGGCTGAACCTCTAGTGTATACTTGTATGAACCCCTTTGCCTCACGATATCGATTAAGCTC[G/A]
AGGCTAGATATGTGCCATCCTCTAATAGCTCAATCATTCACTCGAACATATTGATAGATTATATAACTTGTGATTGACTCCTCGATCACCTTTGACATGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.40%	23.80%	35.00%	5.76%	NA
All Indica	2759	47.50%	8.10%	40.81%	3.62%	NA
All Japonica	1512	20.40%	47.00%	21.56%	10.98%	NA
Aus	269	7.80%	48.70%	42.75%	0.74%	NA
Indica I	595	48.40%	2.40%	45.71%	3.53%	NA
Indica II	465	59.40%	11.00%	27.96%	1.72%	NA
Indica III	913	43.40%	9.20%	43.59%	3.83%	NA
Indica Intermediate	786	44.50%	9.40%	41.48%	4.58%	NA
Temperate Japonica	767	10.30%	76.30%	9.78%	3.65%	NA
Tropical Japonica	504	36.30%	12.50%	35.91%	15.28%	NA
Japonica Intermediate	241	19.50%	26.10%	29.05%	25.31%	NA
VI/Aromatic	96	12.50%	26.00%	61.46%	0.00%	NA
Intermediate	90	25.60%	38.90%	31.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214147827	C -> DEL	N	N	silent_mutation	Average:16.177; most accessible tissue: Zhenshan97 flag leaf, score: 22.512	N	N	N	N
vg1214147827	C -> T	LOC_Os12g24690.1	upstream_gene_variant ; 1631.0bp to feature; MODIFIER	silent_mutation	Average:16.177; most accessible tissue: Zhenshan97 flag leaf, score: 22.512	N	N	N	N
vg1214147827	C -> T	LOC_Os12g24680-LOC_Os12g24690	intergenic_region ; MODIFIER	silent_mutation	Average:16.177; most accessible tissue: Zhenshan97 flag leaf, score: 22.512	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214147827	4.42E-07	NA	mr1022	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827	NA	1.32E-14	mr1023	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827	NA	4.52E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827	NA	1.52E-16	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827	NA	8.46E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827	NA	2.39E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827	NA	1.93E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827	NA	1.73E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214147827	NA	2.82E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251