| Variant ID: vg1214147827 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14147827 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.21, others allele: 0.00, population size: 89. )
CCATGTCAAAGGTGATCGAGGAGTCAATCACAAGTTATATAATCTATCAATATGTTCGAGTGAATGATTGAGCTATTAGAGGATGGCACATATCTAGCCT[C/T]
GAGCTTAATCGATATCGTGAGGCAAAGGGGTTCATACAAGTATACACTAGAGGTTCAGCCGATATGATCTTTATGTATGCCTGGTGGGTCAATATGTTCT
AGAACATATTGACCCACCAGGCATACATAAAGATCATATCGGCTGAACCTCTAGTGTATACTTGTATGAACCCCTTTGCCTCACGATATCGATTAAGCTC[G/A]
AGGCTAGATATGTGCCATCCTCTAATAGCTCAATCATTCACTCGAACATATTGATAGATTATATAACTTGTGATTGACTCCTCGATCACCTTTGACATGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.40% | 23.80% | 35.00% | 5.76% | NA |
| All Indica | 2759 | 47.50% | 8.10% | 40.81% | 3.62% | NA |
| All Japonica | 1512 | 20.40% | 47.00% | 21.56% | 10.98% | NA |
| Aus | 269 | 7.80% | 48.70% | 42.75% | 0.74% | NA |
| Indica I | 595 | 48.40% | 2.40% | 45.71% | 3.53% | NA |
| Indica II | 465 | 59.40% | 11.00% | 27.96% | 1.72% | NA |
| Indica III | 913 | 43.40% | 9.20% | 43.59% | 3.83% | NA |
| Indica Intermediate | 786 | 44.50% | 9.40% | 41.48% | 4.58% | NA |
| Temperate Japonica | 767 | 10.30% | 76.30% | 9.78% | 3.65% | NA |
| Tropical Japonica | 504 | 36.30% | 12.50% | 35.91% | 15.28% | NA |
| Japonica Intermediate | 241 | 19.50% | 26.10% | 29.05% | 25.31% | NA |
| VI/Aromatic | 96 | 12.50% | 26.00% | 61.46% | 0.00% | NA |
| Intermediate | 90 | 25.60% | 38.90% | 31.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214147827 | C -> DEL | N | N | silent_mutation | Average:16.177; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 | N | N | N | N |
| vg1214147827 | C -> T | LOC_Os12g24690.1 | upstream_gene_variant ; 1631.0bp to feature; MODIFIER | silent_mutation | Average:16.177; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 | N | N | N | N |
| vg1214147827 | C -> T | LOC_Os12g24680-LOC_Os12g24690 | intergenic_region ; MODIFIER | silent_mutation | Average:16.177; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214147827 | 4.42E-07 | NA | mr1022 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147827 | NA | 1.32E-14 | mr1023 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147827 | NA | 4.52E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147827 | NA | 1.52E-16 | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147827 | NA | 8.46E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147827 | NA | 2.39E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147827 | NA | 1.93E-08 | mr1606_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147827 | NA | 1.73E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214147827 | NA | 2.82E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |