Variant ID: vg1214120133 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 14120133 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, G: 0.26, others allele: 0.00, population size: 76. )
TATGTTTTTTCTATGTTCCCATTGTTACTTTCCAAGTGTGTTAGCAAATATATGAATTATATAACTTGTAGGCAATCATGAAATGTCTTTCATGTGAGAG[A/G]
TATATAATATATGATGATGAAAGAGAGAGACATGTTTCATCATGCTGTAGTTTTTATATATCAACTAGTTGGGTGCCCGTGCTTTGCAACGGGAAAAAAT
ATTTTTTCCCGTTGCAAAGCACGGGCACCCAACTAGTTGATATATAAAAACTACAGCATGATGAAACATGTCTCTCTCTTTCATCATCATATATTATATA[T/C]
CTCTCACATGAAAGACATTTCATGATTGCCTACAAGTTATATAATTCATATATTTGCTAACACACTTGGAAAGTAACAATGGGAACATAGAAAAAACATA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 57.30% | 25.60% | 3.39% | 13.71% | NA |
All Indica | 2759 | 58.90% | 12.80% | 5.40% | 22.83% | NA |
All Japonica | 1512 | 50.40% | 49.30% | 0.07% | 0.26% | NA |
Aus | 269 | 75.50% | 22.70% | 1.86% | 0.00% | NA |
Indica I | 595 | 55.60% | 9.40% | 4.87% | 30.08% | NA |
Indica II | 465 | 60.40% | 15.90% | 3.44% | 20.22% | NA |
Indica III | 913 | 63.40% | 11.40% | 6.46% | 18.73% | NA |
Indica Intermediate | 786 | 55.30% | 15.30% | 5.73% | 23.66% | NA |
Temperate Japonica | 767 | 81.20% | 18.30% | 0.13% | 0.39% | NA |
Tropical Japonica | 504 | 13.70% | 86.10% | 0.00% | 0.20% | NA |
Japonica Intermediate | 241 | 29.00% | 71.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 76.00% | 16.70% | 1.04% | 6.25% | NA |
Intermediate | 90 | 51.10% | 35.60% | 4.44% | 8.89% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1214120133 | A -> DEL | N | N | silent_mutation | Average:25.639; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
vg1214120133 | A -> G | LOC_Os12g24659.1 | downstream_gene_variant ; 2756.0bp to feature; MODIFIER | silent_mutation | Average:25.639; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
vg1214120133 | A -> G | LOC_Os12g24650-LOC_Os12g24659 | intergenic_region ; MODIFIER | silent_mutation | Average:25.639; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1214120133 | NA | 1.32E-15 | mr1023 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1214120133 | NA | 4.40E-13 | mr1079 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1214120133 | NA | 8.64E-15 | mr1142 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1214120133 | NA | 2.24E-14 | mr1491 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1214120133 | NA | 3.66E-09 | mr1606 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1214120133 | NA | 1.11E-13 | mr1778 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1214120133 | NA | 6.06E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1214120133 | NA | 6.19E-18 | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1214120133 | NA | 6.38E-14 | mr1079_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1214120133 | NA | 4.24E-15 | mr1489_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1214120133 | NA | 3.05E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |