\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214120133:

Variant ID: vg1214120133 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14120133
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, G: 0.26, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTTTTTTCTATGTTCCCATTGTTACTTTCCAAGTGTGTTAGCAAATATATGAATTATATAACTTGTAGGCAATCATGAAATGTCTTTCATGTGAGAG[A/G]
TATATAATATATGATGATGAAAGAGAGAGACATGTTTCATCATGCTGTAGTTTTTATATATCAACTAGTTGGGTGCCCGTGCTTTGCAACGGGAAAAAAT

Reverse complement sequence

ATTTTTTCCCGTTGCAAAGCACGGGCACCCAACTAGTTGATATATAAAAACTACAGCATGATGAAACATGTCTCTCTCTTTCATCATCATATATTATATA[T/C]
CTCTCACATGAAAGACATTTCATGATTGCCTACAAGTTATATAATTCATATATTTGCTAACACACTTGGAAAGTAACAATGGGAACATAGAAAAAACATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 25.60% 3.39% 13.71% NA
All Indica  2759 58.90% 12.80% 5.40% 22.83% NA
All Japonica  1512 50.40% 49.30% 0.07% 0.26% NA
Aus  269 75.50% 22.70% 1.86% 0.00% NA
Indica I  595 55.60% 9.40% 4.87% 30.08% NA
Indica II  465 60.40% 15.90% 3.44% 20.22% NA
Indica III  913 63.40% 11.40% 6.46% 18.73% NA
Indica Intermediate  786 55.30% 15.30% 5.73% 23.66% NA
Temperate Japonica  767 81.20% 18.30% 0.13% 0.39% NA
Tropical Japonica  504 13.70% 86.10% 0.00% 0.20% NA
Japonica Intermediate  241 29.00% 71.00% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 16.70% 1.04% 6.25% NA
Intermediate  90 51.10% 35.60% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214120133 A -> DEL N N silent_mutation Average:25.639; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1214120133 A -> G LOC_Os12g24659.1 downstream_gene_variant ; 2756.0bp to feature; MODIFIER silent_mutation Average:25.639; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1214120133 A -> G LOC_Os12g24650-LOC_Os12g24659 intergenic_region ; MODIFIER silent_mutation Average:25.639; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214120133 NA 1.32E-15 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214120133 NA 4.40E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214120133 NA 8.64E-15 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214120133 NA 2.24E-14 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214120133 NA 3.66E-09 mr1606 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214120133 NA 1.11E-13 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214120133 NA 6.06E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214120133 NA 6.19E-18 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214120133 NA 6.38E-14 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214120133 NA 4.24E-15 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214120133 NA 3.05E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251