| Variant ID: vg1214119279 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14119279 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 126. )
ATGATCATAGAGCACTATATATATTGTTCCCCATTGGTTTATACAATACATTAGTAGTTTAGACTTGGAAAATTATTATTATCCCATGACGGTTGCAATA[G/T]
GTTGTGGAGTTTAGGATATAAAGATATCATAAATTTAGACTTGGATATATAATATACAACACGTTGATTGGATGCAGTTTATTCTAATATAACAGTTGCA
TGCAACTGTTATATTAGAATAAACTGCATCCAATCAACGTGTTGTATATTATATATCCAAGTCTAAATTTATGATATCTTTATATCCTAAACTCCACAAC[C/A]
TATTGCAACCGTCATGGGATAATAATAATTTTCCAAGTCTAAACTACTAATGTATTGTATAAACCAATGGGGAACAATATATATAGTGCTCTATGATCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 7.00% | 1.69% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 1.90% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 77.60% | 17.80% | 4.56% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.50% | 8.60% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 94.80% | 1.40% | 3.78% | 0.00% | NA |
| Tropical Japonica | 504 | 46.40% | 47.20% | 6.35% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 8.30% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 8.90% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214119279 | G -> T | LOC_Os12g24650.1 | downstream_gene_variant ; 4771.0bp to feature; MODIFIER | silent_mutation | Average:30.458; most accessible tissue: Callus, score: 62.565 | N | N | N | N |
| vg1214119279 | G -> T | LOC_Os12g24659.1 | downstream_gene_variant ; 3610.0bp to feature; MODIFIER | silent_mutation | Average:30.458; most accessible tissue: Callus, score: 62.565 | N | N | N | N |
| vg1214119279 | G -> T | LOC_Os12g24650-LOC_Os12g24659 | intergenic_region ; MODIFIER | silent_mutation | Average:30.458; most accessible tissue: Callus, score: 62.565 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214119279 | NA | 4.59E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214119279 | NA | 2.16E-07 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214119279 | 7.97E-07 | NA | mr1546 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214119279 | NA | 1.14E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214119279 | NA | 4.33E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214119279 | NA | 3.63E-06 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |