Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214022772:

Variant ID: vg1214022772 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14022772
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 47. )

Flanking Sequence (100 bp) in Reference Genome:

GTAAGGCGACCGATCTATCCCAATCACTTGATTTAAGTATATATCGATATAAGGATTATATATCATTAATATTTACAGCCGATCGAGTAGATTTAGTTCT[G/T]
ATTTGCTTATTGATATTTGCCGATCGATGCACGCATGACATCGGCTTGAAATAAATGATATGTCATCGGCACCTAGCCGATCGGCTATCATTTATAGGAT

Reverse complement sequence

ATCCTATAAATGATAGCCGATCGGCTAGGTGCCGATGACATATCATTTATTTCAAGCCGATGTCATGCGTGCATCGATCGGCAAATATCAATAAGCAAAT[C/A]
AGAACTAAATCTACTCGATCGGCTGTAAATATTAATGATATATAATCCTTATATCGATATATACTTAAATCAAGTGATTGGGATAGATCGGTCGCCTTAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.00%	9.80%	13.56%	57.66%	NA
All Indica	2759	5.30%	14.30%	19.64%	60.78%	NA
All Japonica	1512	47.60%	0.50%	1.92%	49.93%	NA
Aus	269	0.70%	18.60%	17.47%	63.20%	NA
Indica I	595	1.20%	10.10%	16.47%	72.27%	NA
Indica II	465	11.40%	12.70%	16.13%	59.78%	NA
Indica III	913	3.80%	18.60%	24.53%	53.01%	NA
Indica Intermediate	786	6.50%	13.40%	18.45%	61.70%	NA
Temperate Japonica	767	77.70%	0.10%	1.30%	20.86%	NA
Tropical Japonica	504	11.90%	1.20%	2.58%	84.33%	NA
Japonica Intermediate	241	26.60%	0.40%	2.49%	70.54%	NA
VI/Aromatic	96	2.10%	3.10%	15.62%	79.17%	NA
Intermediate	90	31.10%	7.80%	8.89%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214022772	G -> DEL	N	N	silent_mutation	Average:8.093; most accessible tissue: Callus, score: 37.688	N	N	N	N
vg1214022772	G -> T	LOC_Os12g24540.1	upstream_gene_variant ; 2459.0bp to feature; MODIFIER	silent_mutation	Average:8.093; most accessible tissue: Callus, score: 37.688	N	N	N	N
vg1214022772	G -> T	LOC_Os12g24550.1	downstream_gene_variant ; 3923.0bp to feature; MODIFIER	silent_mutation	Average:8.093; most accessible tissue: Callus, score: 37.688	N	N	N	N
vg1214022772	G -> T	LOC_Os12g24540-LOC_Os12g24550	intergenic_region ; MODIFIER	silent_mutation	Average:8.093; most accessible tissue: Callus, score: 37.688	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214022772	NA	3.52E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	NA	1.05E-09	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	NA	7.26E-11	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	NA	4.31E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	NA	2.14E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	NA	4.82E-06	mr1407	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	7.65E-06	5.67E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	NA	7.16E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	NA	3.44E-08	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	NA	6.58E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	NA	1.64E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	NA	9.76E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	7.76E-06	1.87E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	4.20E-07	7.18E-06	mr1678	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214022772	NA	9.68E-10	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251