\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213796670:

Variant ID: vg1213796670 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13796670
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGGGCTGCCCGCGCTGCTGGACATCCTCGTCATCAGCATCTCTACAAAGGACAAAAGTTCCCGAGGTCAACATACAAAAAGTAAACTAGGATGATAAT[T/C]
GCACGCACGAAGGCGGTCAGAATTCAAGTTTTACACATTGTGTCTGGCAAGTACAAGAAGTCCTACTCTTCAAATAGGGGGAGAACAGACTCCCCCAGAT

Reverse complement sequence

ATCTGGGGGAGTCTGTTCTCCCCCTATTTGAAGAGTAGGACTTCTTGTACTTGCCAGACACAATGTGTAAAACTTGAATTCTGACCGCCTTCGTGCGTGC[A/G]
ATTATCATCCTAGTTTACTTTTTGTATGTTGACCTCGGGAACTTTTGTCCTTTGTAGAGATGCTGATGACGAGGATGTCCAGCAGCGCGGGCAGCCCGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 15.90% 0.97% 8.08% NA
All Indica  2759 96.20% 2.40% 0.58% 0.80% NA
All Japonica  1512 32.10% 43.70% 1.85% 22.35% NA
Aus  269 94.40% 0.70% 0.00% 4.83% NA
Indica I  595 96.80% 1.50% 1.34% 0.34% NA
Indica II  465 93.30% 3.70% 0.43% 2.58% NA
Indica III  913 98.50% 1.30% 0.22% 0.00% NA
Indica Intermediate  786 94.90% 3.60% 0.51% 1.02% NA
Temperate Japonica  767 6.30% 78.20% 0.91% 14.60% NA
Tropical Japonica  504 63.50% 0.80% 3.37% 32.34% NA
Japonica Intermediate  241 49.00% 23.20% 1.66% 26.14% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 66.70% 24.40% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213796670 T -> C LOC_Os12g24200.1 downstream_gene_variant ; 2167.0bp to feature; MODIFIER silent_mutation Average:17.858; most accessible tissue: Zhenshan97 flower, score: 27.882 N N N N
vg1213796670 T -> C LOC_Os12g24210.1 intron_variant ; MODIFIER silent_mutation Average:17.858; most accessible tissue: Zhenshan97 flower, score: 27.882 N N N N
vg1213796670 T -> DEL N N silent_mutation Average:17.858; most accessible tissue: Zhenshan97 flower, score: 27.882 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213796670 NA 3.72E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 2.22E-08 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 1.18E-08 7.21E-11 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 1.82E-11 3.10E-13 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 2.88E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 2.19E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 4.96E-11 1.52E-13 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 2.10E-06 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 7.00E-06 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 8.17E-08 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 4.93E-08 2.92E-12 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 1.45E-36 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 4.79E-23 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 1.65E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 1.36E-34 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 4.69E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 1.26E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 5.73E-06 4.20E-10 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 3.54E-06 NA mr1828_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213796670 NA 9.63E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251