\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213429246:

Variant ID: vg1213429246 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13429246
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCGGTGTTGAAGCCGACTTCCGCCTAGGCCTACGGGGAGAAGACGCCCTTGTAGTGAAGACGGTAGCCAAATCGTCGGGGAGTTTCATCAGGATTGGC[G/A]
GGTAGGCCGCATCATCTTGATCTGGTGGTGTTGGAGTAGATGGGATCTCGTCCGAGTGGTTTGAAGCCGACTCAATCAAGATAAGCTTGGAGTAGATCTC

Reverse complement sequence

GAGATCTACTCCAAGCTTATCTTGATTGAGTCGGCTTCAAACCACTCGGACGAGATCCCATCTACTCCAACACCACCAGATCAAGATGATGCGGCCTACC[C/T]
GCCAATCCTGATGAAACTCCCCGACGATTTGGCTACCGTCTTCACTACAAGGGCGTCTTCTCCCCGTAGGCCTAGGCGGAAGTCGGCTTCAACACCGATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 0.70% 1.54% 8.72% NA
All Indica  2759 99.90% 0.00% 0.04% 0.07% NA
All Japonica  1512 66.60% 2.10% 4.76% 26.59% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.00% 0.00% 0.22% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.00% 0.13% NA
Temperate Japonica  767 88.50% 0.00% 0.78% 10.69% NA
Tropical Japonica  504 32.50% 5.40% 11.11% 50.99% NA
Japonica Intermediate  241 68.00% 1.70% 4.15% 26.14% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 95.60% 1.10% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213429246 G -> DEL LOC_Os12g23660.1 N frameshift_variant Average:47.362; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1213429246 G -> A LOC_Os12g23660.1 missense_variant ; p.Pro92Leu; MODERATE nonsynonymous_codon ; P92L Average:47.362; most accessible tissue: Zhenshan97 panicle, score: 65.386 benign 0.764 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213429246 3.17E-07 1.55E-09 mr1076 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 3.83E-06 2.33E-10 mr1082 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 4.07E-07 4.47E-10 mr1083 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 4.61E-06 4.61E-06 mr1145 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 4.58E-07 NA mr1155 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 5.10E-07 5.10E-07 mr1204 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 1.35E-06 3.12E-09 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 6.51E-08 3.96E-10 mr1408 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 NA 1.59E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 1.85E-07 1.85E-07 mr1436 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 NA 2.92E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 NA 2.53E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 8.59E-08 8.59E-08 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 NA 9.94E-09 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 NA 2.80E-09 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 NA 4.81E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 9.14E-06 1.69E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 NA 5.39E-07 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 3.82E-07 2.04E-10 mr1226_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213429246 NA 9.07E-08 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251