\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213328042:

Variant ID: vg1213328042 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13328042
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTTGAATTCCAAACTTGTGCGTCAAGAAAATACCCGGGATCCTAGTCGGTTACAATTGTATCTTATCTGTAACTACCTATTCTGTTAGGGATATGGACT[G/A]
TGCTTTGTAATACGGACCCCTTCCCCTATATAAGGAGGGGTCCGGGTGCCTCTAGGGGCACGATTTTCTTCCAGATCATACGATCAATAATATACTCGGC

Reverse complement sequence

GCCGAGTATATTATTGATCGTATGATCTGGAAGAAAATCGTGCCCCTAGAGGCACCCGGACCCCTCCTTATATAGGGGAAGGGGTCCGTATTACAAAGCA[C/T]
AGTCCATATCCCTAACAGAATAGGTAGTTACAGATAAGATACAATTGTAACCGACTAGGATCCCGGGTATTTTCTTGACGCACAAGTTTGGAATTCAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.90% 2.40% 1.90% 74.80% NA
All Indica  2759 7.10% 3.10% 1.74% 88.00% NA
All Japonica  1512 49.00% 0.90% 1.06% 49.07% NA
Aus  269 3.00% 3.00% 4.09% 89.96% NA
Indica I  595 11.60% 3.00% 2.18% 83.19% NA
Indica II  465 7.30% 2.40% 2.15% 88.17% NA
Indica III  913 2.30% 3.20% 1.53% 92.99% NA
Indica Intermediate  786 9.30% 3.60% 1.40% 85.75% NA
Temperate Japonica  767 82.40% 0.10% 0.13% 17.34% NA
Tropical Japonica  504 8.50% 1.60% 2.18% 87.70% NA
Japonica Intermediate  241 27.40% 1.70% 1.66% 69.29% NA
VI/Aromatic  96 6.20% 6.20% 11.46% 76.04% NA
Intermediate  90 37.80% 2.20% 4.44% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213328042 G -> DEL N N silent_mutation Average:8.17; most accessible tissue: Callus, score: 24.258 N N N N
vg1213328042 G -> A LOC_Os12g23540.1 upstream_gene_variant ; 1262.0bp to feature; MODIFIER silent_mutation Average:8.17; most accessible tissue: Callus, score: 24.258 N N N N
vg1213328042 G -> A LOC_Os12g23550.1 downstream_gene_variant ; 634.0bp to feature; MODIFIER silent_mutation Average:8.17; most accessible tissue: Callus, score: 24.258 N N N N
vg1213328042 G -> A LOC_Os12g23540-LOC_Os12g23550 intergenic_region ; MODIFIER silent_mutation Average:8.17; most accessible tissue: Callus, score: 24.258 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213328042 7.36E-06 NA mr1536 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251