Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1213328042:

Variant ID: vg1213328042 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13328042
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTTGAATTCCAAACTTGTGCGTCAAGAAAATACCCGGGATCCTAGTCGGTTACAATTGTATCTTATCTGTAACTACCTATTCTGTTAGGGATATGGACT[G/A]
TGCTTTGTAATACGGACCCCTTCCCCTATATAAGGAGGGGTCCGGGTGCCTCTAGGGGCACGATTTTCTTCCAGATCATACGATCAATAATATACTCGGC

Reverse complement sequence

GCCGAGTATATTATTGATCGTATGATCTGGAAGAAAATCGTGCCCCTAGAGGCACCCGGACCCCTCCTTATATAGGGGAAGGGGTCCGTATTACAAAGCA[C/T]
AGTCCATATCCCTAACAGAATAGGTAGTTACAGATAAGATACAATTGTAACCGACTAGGATCCCGGGTATTTTCTTGACGCACAAGTTTGGAATTCAACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.90%	2.40%	1.90%	74.80%	NA
All Indica	2759	7.10%	3.10%	1.74%	88.00%	NA
All Japonica	1512	49.00%	0.90%	1.06%	49.07%	NA
Aus	269	3.00%	3.00%	4.09%	89.96%	NA
Indica I	595	11.60%	3.00%	2.18%	83.19%	NA
Indica II	465	7.30%	2.40%	2.15%	88.17%	NA
Indica III	913	2.30%	3.20%	1.53%	92.99%	NA
Indica Intermediate	786	9.30%	3.60%	1.40%	85.75%	NA
Temperate Japonica	767	82.40%	0.10%	0.13%	17.34%	NA
Tropical Japonica	504	8.50%	1.60%	2.18%	87.70%	NA
Japonica Intermediate	241	27.40%	1.70%	1.66%	69.29%	NA
VI/Aromatic	96	6.20%	6.20%	11.46%	76.04%	NA
Intermediate	90	37.80%	2.20%	4.44%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213328042	G -> DEL	N	N	silent_mutation	Average:8.17; most accessible tissue: Callus, score: 24.258	N	N	N	N
vg1213328042	G -> A	LOC_Os12g23540.1	upstream_gene_variant ; 1262.0bp to feature; MODIFIER	silent_mutation	Average:8.17; most accessible tissue: Callus, score: 24.258	N	N	N	N
vg1213328042	G -> A	LOC_Os12g23550.1	downstream_gene_variant ; 634.0bp to feature; MODIFIER	silent_mutation	Average:8.17; most accessible tissue: Callus, score: 24.258	N	N	N	N
vg1213328042	G -> A	LOC_Os12g23540-LOC_Os12g23550	intergenic_region ; MODIFIER	silent_mutation	Average:8.17; most accessible tissue: Callus, score: 24.258	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213328042	7.36E-06	NA	mr1536	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251