\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213171598:

Variant ID: vg1213171598 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13171598
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TCGATTTCATATGCTTAACGGCTGGACTATTCATTATTCCCCACAAGGGCTATCAACCGACTACTTGCGCTAGTCGGGATTCAATTTTTATATCTATTTT[G/A]
GAGTATCCCATAAGGGATAATCACTCAGATCAGAAGCTATTCTTATGAGCTACAGTTGGTCTATATCACCCGGAAGATTTATTACTCAGGAGCATGTTAC

Reverse complement sequence

GTAACATGCTCCTGAGTAATAAATCTTCCGGGTGATATAGACCAACTGTAGCTCATAAGAATAGCTTCTGATCTGAGTGATTATCCCTTATGGGATACTC[C/T]
AAAATAGATATAAAAATTGAATCCCGACTAGCGCAAGTAGTCGGTTGATAGCCCTTGTGGGGAATAATGAATAGTCCAGCCGTTAAGCATATGAAATCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.70% 30.90% 2.12% 28.31% NA
All Indica  2759 22.80% 26.70% 3.37% 47.08% NA
All Japonica  1512 53.00% 45.90% 0.07% 0.99% NA
Aus  269 99.30% 0.00% 0.37% 0.37% NA
Indica I  595 13.30% 4.40% 3.70% 78.66% NA
Indica II  465 22.20% 52.30% 0.22% 25.38% NA
Indica III  913 24.10% 24.50% 5.04% 46.33% NA
Indica Intermediate  786 28.90% 31.20% 3.05% 36.90% NA
Temperate Japonica  767 16.60% 82.10% 0.13% 1.17% NA
Tropical Japonica  504 97.80% 1.00% 0.00% 1.19% NA
Japonica Intermediate  241 75.50% 24.50% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 0.00% 3.12% 10.42% NA
Intermediate  90 53.30% 30.00% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213171598 G -> DEL N N silent_mutation Average:22.906; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg1213171598 G -> A LOC_Os12g23260-LOC_Os12g23280 intergenic_region ; MODIFIER silent_mutation Average:22.906; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213171598 NA 9.18E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1213171598 NA 8.50E-15 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 3.10E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 4.15E-14 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 3.26E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 9.10E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 3.80E-14 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 1.01E-08 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 8.54E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 9.74E-07 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 2.41E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 2.81E-13 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 1.62E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 1.17E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 1.50E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 3.97E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 1.29E-10 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 7.26E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 6.97E-14 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 1.27E-10 mr1815_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 2.42E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 5.09E-12 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213171598 NA 6.50E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251