Variant ID: vg1213066313 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 13066313 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )
CGGCTAAGTGCCGTAATTCGGCCTGCAAGCTTTTGTACCTCATGTACACTTGACGGGGGCTTCATTTGCTGAATGGCGTCGATTTTCTCGGGGTTCGCTT[C/T]
GATGCCTCTTTCGGAAACCAGGAAACCCAGCAACTTGCCCGCGCGAATGCCGAAGACACACTTCTCAGGATTCAGTTTTATGCCCGCTGCGCGCAAGTTG
CAACTTGCGCGCAGCGGGCATAAAACTGAATCCTGAGAAGTGTGTCTTCGGCATTCGCGCGGGCAAGTTGCTGGGTTTCCTGGTTTCCGAAAGAGGCATC[G/A]
AAGCGAACCCCGAGAAAATCGACGCCATTCAGCAAATGAAGCCCCCGTCAAGTGTACATGAGGTACAAAAGCTTGCAGGCCGAATTACGGCACTTAGCCG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 83.10% | 15.50% | 1.33% | 0.06% | NA |
All Indica | 2759 | 95.70% | 2.20% | 1.96% | 0.11% | NA |
All Japonica | 1512 | 60.60% | 39.10% | 0.33% | 0.00% | NA |
Aus | 269 | 80.70% | 18.60% | 0.74% | 0.00% | NA |
Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 85.40% | 6.20% | 7.96% | 0.43% | NA |
Indica III | 913 | 97.70% | 1.40% | 0.77% | 0.11% | NA |
Indica Intermediate | 786 | 96.60% | 2.20% | 1.27% | 0.00% | NA |
Temperate Japonica | 767 | 88.30% | 11.50% | 0.26% | 0.00% | NA |
Tropical Japonica | 504 | 18.80% | 80.80% | 0.40% | 0.00% | NA |
Japonica Intermediate | 241 | 59.80% | 39.80% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
Intermediate | 90 | 82.20% | 15.60% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1213066313 | C -> DEL | LOC_Os12g23110.1 | N | frameshift_variant | Average:42.737; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
vg1213066313 | C -> T | LOC_Os12g23110.1 | missense_variant ; p.Glu501Lys; MODERATE | nonsynonymous_codon ; E501K | Average:42.737; most accessible tissue: Minghui63 flag leaf, score: 67.635 | unknown | unknown | DELETERIOUS | 0.02 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1213066313 | NA | 6.50E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1213066313 | NA | 4.50E-10 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1213066313 | NA | 2.30E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1213066313 | NA | 2.56E-08 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1213066313 | 9.30E-06 | 9.30E-06 | mr1605 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1213066313 | 1.68E-06 | 2.46E-07 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1213066313 | 2.07E-06 | NA | mr1890 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1213066313 | NA | 4.45E-06 | mr1890 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |