Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212617202:

Variant ID: vg1212617202 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12617202
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.25, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCTCCTCTTGCACACAATTAGCGATGAGCTTTTCAAAGTTCCATTTCTCTGGACTTATATTGTAGTTGACAAAAAAGTTGTTAAAGTGCTTTGGCAAT[G/A]
AGACCATAACCAGATGGACCAGAAAGTCATCTGAGATGCCCAAATCTATTGGCTTCAACTTGGAAGCCATGTTGCTCATCCTAAGAATGTGGTCTCTTAC

Reverse complement sequence

GTAAGAGACCACATTCTTAGGATGAGCAACATGGCTTCCAAGTTGAAGCCAATAGATTTGGGCATCTCAGATGACTTTCTGGTCCATCTGGTTATGGTCT[C/T]
ATTGCCAAAGCACTTTAACAACTTTTTTGTCAACTACAATATAAGTCCAGAGAAATGGAACTTTGAAAAGCTCATCGCTAATTGTGTGCAAGAGGAGGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.90%	28.30%	0.32%	9.46%	NA
All Indica	2759	60.20%	23.50%	0.51%	15.84%	NA
All Japonica	1512	56.20%	43.50%	0.07%	0.26%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	53.10%	3.50%	1.18%	42.18%	NA
Indica II	465	56.60%	38.10%	0.65%	4.73%	NA
Indica III	913	67.90%	24.40%	0.00%	7.67%	NA
Indica Intermediate	786	58.70%	28.90%	0.51%	11.96%	NA
Temperate Japonica	767	22.60%	77.30%	0.00%	0.13%	NA
Tropical Japonica	504	98.00%	1.40%	0.00%	0.60%	NA
Japonica Intermediate	241	75.90%	23.70%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	60.00%	33.30%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212617202	G -> DEL	LOC_Os12g22350.1	N	frameshift_variant	Average:30.747; most accessible tissue: Minghui63 flag leaf, score: 64.284	N	N	N	N
vg1212617202	G -> A	LOC_Os12g22350.1	missense_variant ; p.Ser24Leu; MODERATE	nonsynonymous_codon ; S24L	Average:30.747; most accessible tissue: Minghui63 flag leaf, score: 64.284	possibly damaging	1.746	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212617202	NA	2.37E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	3.59E-11	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	1.79E-06	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	1.77E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	7.52E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	7.54E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	7.69E-11	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	1.50E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	2.29E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	2.38E-08	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	1.57E-08	mr1425_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	7.96E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212617202	NA	1.33E-12	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251