| Variant ID: vg1211969945 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 11969945 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTCATTCCGGTCAAAAACATCGCACCCACGTGTGCGAATATATGCCAATATTGGCATTAACTGACAAAAGTTCGCCGCGCGAATCACGAAGTGAGTTTT[A/T]
GCCAAGAACGTACCCAATACACTCCAATATGTCCAAAATTCATGTTTTGGTGCTCTTTGAACTTTTTCATTCCGGTCAAAAACAACGCACCCACGTGTGC
GCACACGTGGGTGCGTTGTTTTTGACCGGAATGAAAAAGTTCAAAGAGCACCAAAACATGAATTTTGGACATATTGGAGTGTATTGGGTACGTTCTTGGC[T/A]
AAAACTCACTTCGTGATTCGCGCGGCGAACTTTTGTCAGTTAATGCCAATATTGGCATATATTCGCACACGTGGGTGCGATGTTTTTGACCGGAATGAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.30% | 0.40% | 46.15% | 19.17% | NA |
| All Indica | 2759 | 17.00% | 0.50% | 61.94% | 20.55% | NA |
| All Japonica | 1512 | 55.10% | 0.10% | 24.21% | 20.57% | NA |
| Aus | 269 | 77.30% | 0.00% | 19.70% | 2.97% | NA |
| Indica I | 595 | 16.10% | 1.20% | 68.07% | 14.62% | NA |
| Indica II | 465 | 17.80% | 0.00% | 54.84% | 27.31% | NA |
| Indica III | 913 | 11.70% | 0.20% | 67.25% | 20.81% | NA |
| Indica Intermediate | 786 | 23.20% | 0.80% | 55.34% | 20.74% | NA |
| Temperate Japonica | 767 | 85.50% | 0.00% | 7.04% | 7.43% | NA |
| Tropical Japonica | 504 | 15.30% | 0.20% | 49.21% | 35.32% | NA |
| Japonica Intermediate | 241 | 41.50% | 0.40% | 26.56% | 31.54% | NA |
| VI/Aromatic | 96 | 67.70% | 0.00% | 21.88% | 10.42% | NA |
| Intermediate | 90 | 53.30% | 0.00% | 35.56% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1211969945 | A -> DEL | N | N | silent_mutation | Average:20.629; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg1211969945 | A -> T | LOC_Os12g20470.1 | downstream_gene_variant ; 4189.0bp to feature; MODIFIER | silent_mutation | Average:20.629; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg1211969945 | A -> T | LOC_Os12g20470-LOC_Os12g21470 | intergenic_region ; MODIFIER | silent_mutation | Average:20.629; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1211969945 | NA | 2.48E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211969945 | NA | 5.34E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211969945 | NA | 2.56E-06 | mr1558 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211969945 | NA | 3.21E-10 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211969945 | NA | 6.23E-08 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211969945 | NA | 2.13E-07 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211969945 | NA | 2.66E-11 | mr1558_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |